Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34077
Trapped Gene
AC182749.2-203 (ENSMUSG00000079709)
Vector Insertion
Chr 17: 15125068 - 15125861
Public Clones IST10826G3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703649 (Chr17:15125038..15125067 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703649 (Chr17:15125038..15125067 +)
Downstram Exon
ENSMUSE00000703648 (Chr17:15125862..15125930 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAAGGAAGCTGGTTCATGCT Chr17:15125911..15125930 60.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000716076 Chr17:15115829..15115863 No primer for this exon
upstream ENSMUSE00000658235 Chr17:15116465..15116633 TTACCAGGGGATTCCATGAC Chr17:15116468..15116487 59.6 50
upstream ENSMUSE00000703662 Chr17:15117222..15117361 GGCGAAGTCTGGACTACAGG Chr17:15117222..15117241 59.87 60
upstream ENSMUSE00000703661 Chr17:15118540..15118641 CTCGGCGTGATGAAACTAGC Chr17:15118594..15118613 60.93 55
upstream ENSMUSE00000703660 Chr17:15119264..15119353 GAAAGAGTGCCCCTTTCTCC Chr17:15119281..15119300 60.19 55
upstream ENSMUSE00000658227 Chr17:15119853..15119873 No primer for this exon
upstream ENSMUSE00000703658 Chr17:15121782..15121879 GCGGACTCAACCTGAGAAAC Chr17:15121816..15121835 59.85 55
upstream ENSMUSE00000703657 Chr17:15122738..15122874 TGGCACATCGACCTTTTGTA Chr17:15122818..15122837 60.11 45
upstream ENSMUSE00000703656 Chr17:15123682..15123796 GAGCAAGTTCAAGTCGCACA Chr17:15123776..15123795 60.18 50
upstream ENSMUSE00000703652 Chr17:15124560..15124662 No primer for this exon
upstream ENSMUSE00000703649 Chr17:15125038..15125067 No primer for this exon

*** Putative Vector Insertion (Chr 17: 15125068 - 15125861) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000703648 Chr17:15125862..15125930 CAAGGAAGCTGGTTCATGCT Chr17:15125911..15125930 60.4 50
downstream ENSMUSE00000658240 Chr17:15127511..15127768 GTTGATCTCCCCATGGCTTA Chr17:15127588..15127607 59.89 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTTTCTAATCGCCTTGCAG Chr17:15125112..15125133 59.62 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTCCGTGACTGGGAAAAC Chr17:15125114..15125134 59.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079709