Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34078
Trapped Gene
AC161410.3 (ENSMUSG00000074251)
Vector Insertion
Chr 8: 73613825 - 73660227
Public Clones IST10016E12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682666 (Chr8:73613742..73613824 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTTAGCAGCAAAGTGTGCAA Chr8:73613800..73613820 59.68 38.1 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682666 (Chr8:73613742..73613824 +)
Downstram Exon
ENSMUSE00000637952 (Chr8:73660228..73660484 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTTAGCAGCAAAGTGTGCAA Chr8:73613800..73613820 59.68 38.1 TGAGGACGCATGCATCTAAG Chr8:73660340..73660359 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682672 Chr8:73550691..73551104 CTTTATGGCCAGCTTTTTGC Chr8:73551005..73551024 59.85 45
upstream ENSMUSE00000682671 Chr8:73552197..73552251 CAGCCCATTGATGCCATTAC Chr8:73552222..73552241 61.26 50
upstream ENSMUSE00000682670 Chr8:73567840..73567911 TGTTCCTGCTCCCTTGACTT Chr8:73567863..73567882 59.84 50
upstream ENSMUSE00000682669 Chr8:73568949..73569086 CCAAGCAGGAAGTTGGAGAG Chr8:73568978..73568997 59.98 55
upstream ENSMUSE00000682668 Chr8:73569154..73569319 TTTCCTCAAGGGAAGCTCCT Chr8:73569255..73569274 60.32 50
upstream ENSMUSE00000636253 Chr8:73611710..73611824 CATTATGCATTTGCCCACAA Chr8:73611720..73611739 60.33 40
upstream ENSMUSE00000682667 Chr8:73612691..73612864 CCCAACGAGACAATGTGGAT Chr8:73612695..73612714 60.78 50
upstream ENSMUSE00000682666 Chr8:73613742..73613824 TTTTAGCAGCAAAGTGTGCAA Chr8:73613800..73613820 59.68 38.1

*** Putative Vector Insertion (Chr 8: 73613825 - 73660227) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000637952 Chr8:73660228..73660484 TGAGGACGCATGCATCTAAG Chr8:73660340..73660359 59.97 50
downstream ENSMUSE00000636250 Chr8:73663252..73663366 GTGTACAGCCTGCATCATCC Chr8:73663358..73663377 59.12 55
downstream ENSMUSE00000682665 Chr8:73663324..73663366 GTGTACAGCCTGCATCATCC Chr8:73663358..73663377 59.12 55
downstream ENSMUSE00000636249 Chr8:73664178..73664351 AGATTTGGATCCGCATTGTG Chr8:73664245..73664264 60.86 45
downstream ENSMUSE00000682663 Chr8:73664178..73664354 AGATTTGGATCCGCATTGTG Chr8:73664245..73664264 60.86 45
downstream ENSMUSE00000682659 Chr8:73665236..73665318 TTTTGCACACTTCGCTGCTA Chr8:73665319..73665338 60.72 45
downstream ENSMUSE00000682658 Chr8:73667097..73667149 No primer for this exon
downstream ENSMUSE00000682657 Chr8:73674277..73675969 GGCCTTCACCTCTATGGTCA Chr8:73674976..73674995 60.07 55
downstream ENSMUSE00000682655 Chr8:73678097..73678160 TGGAATCCAGGAAACCAAGT Chr8:73678147..73678166 59.38 45
downstream ENSMUSE00000637950 Chr8:73686414..73686456 No primer for this exon
downstream ENSMUSE00000682653 Chr8:73687822..73687959 CTCTCCCCGAGAACACACAT Chr8:73687923..73687942 60.11 55
downstream ENSMUSE00000682652 Chr8:73693816..73694218 TCAGGTGCAAGTTGTGAAGG Chr8:73694030..73694049 59.87 50
downstream ENSMUSE00000682651 Chr8:73694411..73694686 ATCAAGGGCATTACCAGCAG Chr8:73694576..73694595 60.1 50
downstream ENSMUSE00000682650 Chr8:73695233..73695355 TCCTCACACATTTTGTCTGGAT Chr8:73695293..73695314 59.45 40.91

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTAATCGCCTTGCAGCAC Chr8:73622873..73622893 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATTCCGTGACTGGGAAAACC Chr8:73634871..73634892 61.08 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074251