Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34083
Trapped Gene
Txndc14 (ENSMUSG00000050043)
Vector Insertion
Chr 2: 84518007 - 84518986
Public Clones IST14098D1 (tigm) IST10389E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000688656 (Chr2:84518800..84518985 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTCACACCTAGCGGGACA Chr2:84518879..84518898 60.68 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000688656 (Chr2:84518800..84518985 -)
Downstram Exon
ENSMUSE00000688655 (Chr2:84518008..84518331 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTCACACCTAGCGGGACA Chr2:84518879..84518898 60.68 55 ACTCTCTCGCAGGCTCACTC Chr2:84518186..84518205 59.89 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688656 Chr2:84518800..84518985 ATCTCACACCTAGCGGGACA Chr2:84518879..84518898 60.68 55
upstream ENSMUSE00000445137 Chr2:84518008..84518213 GCCTCTGATTGCTTTGGTGT Chr2:84518163..84518182 60.26 50
upstream ENSMUSE00000688652 Chr2:84518008..84518275 GAGTGAGCCTGCGAGAGAGT Chr2:84518208..84518227 59.89 60
upstream ENSMUSE00000688655 Chr2:84518008..84518331 GAGTGAGCCTGCGAGAGAGT Chr2:84518208..84518227 59.89 60

*** Putative Vector Insertion (Chr 2: 84518007 - 84518986) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000480467 Chr2:84516254..84516314 TCTGCGGTTCTTCATCATCA Chr2:84516236..84516255 60.35 45
downstream ENSMUSE00000479523 Chr2:84515902..84516015 CCCATTCGAATATCCAGTCG Chr2:84515906..84515925 60.29 50
downstream ENSMUSE00000482302 Chr2:84515562..84515638 CTTGCAGGTCATCAGGAACA Chr2:84515597..84515616 59.83 50
downstream ENSMUSE00000481301 Chr2:84513657..84513763 GAGGGACAAGTCCGCATAGA Chr2:84513637..84513656 60.22 55
downstream ENSMUSE00000476536 Chr2:84513411..84513476 AACGTCAGTGTAGCGTCCAA Chr2:84513397..84513416 59.37 50
downstream ENSMUSE00000479326 Chr2:84513181..84513310 GGTAGGGAGCTGTCTGGTGA Chr2:84513246..84513265 60.26 60
downstream ENSMUSE00000478305 Chr2:84511474..84512689 CCCTTCGAGAAACAGCTGAC Chr2:84512301..84512320 59.99 55
downstream ENSMUSE00000688654 Chr2:84511473..84512689 CCCTTCGAGAAACAGCTGAC Chr2:84512301..84512320 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATCGCCAAAGGGCTTAAT Chr2:84518931..84518951 60.41 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCACCCCAGAAAATCAAGT Chr2:84518967..84518987 61.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050043