Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34113
Trapped Gene
AC129222.4-202 (ENSMUSG00000058570)
Vector Insertion
Chr 14: 8589506 - 8597369
Public Clones IST14885E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000565305 (Chr14:8597296..8597368 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGTGAAGCAGCCTCAGATG Chr14:8597299..8597318 59.58 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000565305 (Chr14:8597296..8597368 -)
Downstram Exon
ENSMUSE00000650969 (Chr14:8589507..8589619 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGTGAAGCAGCCTCAGATG Chr14:8597299..8597318 59.58 55 TCTTGCAACTGTGCTTCCTG Chr14:8589575..8589594 60.17 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711789 Chr14:8623922..8624104 CCCAGATACCTCGCTGGATA Chr14:8624033..8624052 60.05 55
upstream ENSMUSE00000306576 Chr14:8622532..8622646 CAACTGCACGCCTCTCATTA Chr14:8622534..8622553 60.01 50
upstream ENSMUSE00000306572 Chr14:8620995..8621168 GGAAACACTGCCCTCCACTA Chr14:8621071..8621090 60.11 55
upstream ENSMUSE00000565309 Chr14:8609025..8609326 GCAGGACATAGACCTGCACA Chr14:8609173..8609192 59.86 55
upstream ENSMUSE00000708370 Chr14:8603655..8603816 GGCTATTTTCCGGGAGATTC Chr14:8603748..8603767 59.87 50
upstream ENSMUSE00000565306 Chr14:8598729..8598762 CCCTGCAAAGAGCACATCTA Chr14:8598743..8598762 59.02 50
upstream ENSMUSE00000565305 Chr14:8597296..8597368 GTGTGAAGCAGCCTCAGATG Chr14:8597299..8597318 59.58 55
upstream ENSMUSE00000650969 Chr14:8589507..8589619 CAGGAAGCACAGTTGCAAGA Chr14:8589597..8589616 60.17 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTAATCGCCTTGCAGCAC Chr14:8591301..8591321 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCCAAGAAGCAAATCAAC Chr14:8594349..8594369 59.32 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058570