Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34114
Trapped Gene
Rlbp1l1 (ENSMUSG00000041216)
Vector Insertion
Chr 4: 9198679 - 9208534
Public Clones IST14885E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676371 (Chr4:9198602..9198678 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCAAAGACGCTGTCTTCCT Chr4:9198633..9198652 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676371 (Chr4:9198602..9198678 +)
Downstram Exon
ENSMUSE00000353704 (Chr4:9208535..9209159 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCAAAGACGCTGTCTTCCT Chr4:9198633..9198652 59.99 50 AAACCCAATGTCTGGTCTGG Chr4:9208911..9208930 59.82 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000439686 Chr4:9196509..9196618 ATCTCACCCACCCAGTTCAG Chr4:9196542..9196561 59.96 55
upstream ENSMUSE00000676371 Chr4:9198602..9198678 TCCAAAGACGCTGTCTTCCT Chr4:9198633..9198652 59.99 50

*** Putative Vector Insertion (Chr 4: 9198679 - 9208534) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000353704 Chr4:9208535..9209159 AAACCCAATGTCTGGTCTGG Chr4:9208911..9208930 59.82 50
downstream ENSMUSE00000716023 Chr4:9208535..9209159 AAACCCAATGTCTGGTCTGG Chr4:9208911..9208930 59.82 50
downstream ENSMUSE00000252733 Chr4:9277794..9277968 AGAGGGTGTCAGCTTGGATG Chr4:9277941..9277960 60.26 55
downstream ENSMUSE00000252726 Chr4:9351333..9351443 GTACAGGGCGTGGATGTACC Chr4:9351404..9351423 60.26 60
downstream ENSMUSE00000252719 Chr4:9356887..9357122 ACATGCATGGCATTGTAGGA Chr4:9357071..9357090 59.96 45
downstream ENSMUSE00000370207 Chr4:9376537..9378838 AACCTGGAGAGGGTTCCTGT Chr4:9376993..9377012 59.97 55
downstream ENSMUSE00000676374 Chr4:9376537..9378830 AACCTGGAGAGGGTTCCTGT Chr4:9376993..9377012 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGAGATAATCGCCTTGCAG Chr4:9198723..9198744 59.33 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAATTTCCTGAGGCTGGTA Chr4:9198663..9198683 60.21 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041216