Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34115
Trapped Gene
Usp9y (ENSMUSG00000069044)
Vector Insertion
Chr Y: 732052 - 748966
Public Clones IST14885E7 (tigm) IST14277A6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000626485 (ChrY:748861..748965 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGCTTGGAATTTTTCTCC ChrY:748895..748914 59.13 40 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000626485 (ChrY:748861..748965 -)
Downstram Exon
ENSMUSE00000647288 (ChrY:732053..732259 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGCTTGGAATTTTTCTCC ChrY:748895..748914 59.13 40 GCACTGAGAGCCAGATCCAT ChrY:732065..732084 60.38 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000647292 ChrY:795966..796225 CTTTCCTTCACGTTGGTGGT ChrY:796109..796128 60.01 50
upstream ENSMUSE00000647291 ChrY:795329..795363 No primer for this exon
upstream ENSMUSE00000647290 ChrY:791051..791127 CCTGTGAGGAATCCAGAGTTG ChrY:791079..791099 59.71 52.38
upstream ENSMUSE00000557453 ChrY:790613..790754 ATCACAACTCGTGGCTCTCC ChrY:790683..790702 60.27 55
upstream ENSMUSE00000626493 ChrY:785294..785439 CCATATGAACAAGGCCAAGG ChrY:785375..785394 60.32 50
upstream ENSMUSE00000626492 ChrY:783273..783352 TGTTTTGCCAAAGGGAGAAT ChrY:783315..783334 59.55 40
upstream ENSMUSE00000626491 ChrY:780946..781058 AGGCTGTGAGTGGATGGAAG ChrY:780958..780977 60.26 55
upstream ENSMUSE00000626490 ChrY:778828..779046 GCACGTCCATGTGAATCAGT ChrY:778895..778914 59.56 50
upstream ENSMUSE00000626489 ChrY:771702..771817 CCAGATTTTGCATGATCGTTT ChrY:771750..771770 59.95 38.1
upstream ENSMUSE00000626488 ChrY:771249..771500 CCGTTTGGACAGTGCTATGA ChrY:771480..771499 59.72 50
upstream ENSMUSE00000626487 ChrY:770746..770881 TAACCGTTGAGCGAATGACA ChrY:770746..770765 60.26 45
upstream ENSMUSE00000626486 ChrY:768616..768768 No primer for this exon
upstream ENSMUSE00000626485 ChrY:748861..748965 TTGGCTTGGAATTTTTCTCC ChrY:748895..748914 59.13 40
upstream ENSMUSE00000647288 ChrY:732053..732259 CAGTGATGACGTGCCTGTAGA ChrY:732111..732131 59.91 52.38

*** Putative Vector Insertion (Chr Y: 732052 - 748966) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000647286 ChrY:730412..730548 TTGAGGTGCTTCACCAAACA ChrY:730398..730417 60.28 45
downstream ENSMUSE00000647284 ChrY:727718..727851 CACGGGGACTTTGATGAGTT ChrY:727807..727826 59.97 50
downstream ENSMUSE00000626480 ChrY:721713..721800 AGCCGTTCTTGGACTTCTTG ChrY:721703..721722 59.47 50
downstream ENSMUSE00000626479 ChrY:720635..720977 AGAGCCAGAGTTGACCATCC ChrY:720924..720943 59.26 55
downstream ENSMUSE00000626478 ChrY:719759..719854 TGGGACCAAGGCTTGTGTAT ChrY:719754..719773 60.38 50
downstream ENSMUSE00000626477 ChrY:717627..717841 TTCAAGCGATCAAAGCAAGA ChrY:717773..717792 59.69 40
downstream ENSMUSE00000626476 ChrY:704471..704711 TCGCACAGAACCAATGGTAG ChrY:704578..704597 59.72 50
downstream ENSMUSE00000626475 ChrY:703499..703651 TATGGTTTCCAGGAGGTCCA ChrY:703536..703555 60.31 50
downstream ENSMUSE00000626474 ChrY:701104..701224 AGTTGGCACAGTCAACATGC ChrY:701125..701144 59.76 50
downstream ENSMUSE00000568545 ChrY:693177..693307 GGAGGCAGAAGAACCAAAGA ChrY:693176..693195 59.4 50
downstream ENSMUSE00000568544 ChrY:692582..692860 ATGGCCATAGCCAACGATAG ChrY:692620..692639 59.94 50
downstream ENSMUSE00000568543 ChrY:688593..688718 AAGGGCATTTTGTAGCACCA ChrY:688649..688668 60.5 45
downstream ENSMUSE00000568541 ChrY:688305..688430 CTGCTGCCCAGATGATTTTT ChrY:688345..688364 60.21 45
downstream ENSMUSE00000568540 ChrY:686969..687138 GTCATCACTTCCAGGGCTTC ChrY:687046..687065 59.66 55
downstream ENSMUSE00000568538 ChrY:678215..678323 AGAACTGCTCCTGTGCCAAC ChrY:678270..678289 60.45 55
downstream ENSMUSE00000568537 ChrY:677864..678010 ACCCTTCTCGTTAGCTGCAC ChrY:677968..677987 59.5 55
downstream ENSMUSE00000568536 ChrY:676435..676581 CCCAGATGGCCTTCTAAGATT ChrY:676498..676518 59.56 47.62
downstream ENSMUSE00000568534 ChrY:672707..672929 AGCTTTGGATGCAGGAAAGA ChrY:672869..672888 59.96 45
downstream ENSMUSE00000568533 ChrY:670057..670277 CAGCATTTTTCAGTCCCACA ChrY:670172..670191 59.69 45
downstream ENSMUSE00000568530 ChrY:668764..668954 TGAGAAGCAGCTAAATGTCCAA ChrY:668784..668805 60.02 40.91
downstream ENSMUSE00000568528 ChrY:661302..661475 GATCAGCAAAGGATCCTCCA ChrY:661308..661327 60.16 50
downstream ENSMUSE00000568526 ChrY:655500..655641 TGATATGCATTTGCACCCTCT ChrY:655500..655520 60.48 42.86
downstream ENSMUSE00000568523 ChrY:652906..653653 CCATCTTTTCTGACGCCTGT ChrY:653128..653147 60.26 50
downstream ENSMUSE00000568521 ChrY:652368..652491 GGCAGGTCCACGGATTATTT ChrY:652354..652373 61.07 50
downstream ENSMUSE00000568518 ChrY:651006..651243 ATTCTTGCTGTGACGGAGGA ChrY:651182..651201 60.8 50
downstream ENSMUSE00000568516 ChrY:650171..650300 GTCGCCCATGTTCAGAAACT ChrY:650194..650213 60.12 50
downstream ENSMUSE00000568513 ChrY:646953..647138 CCTGGTCCTTCATCCAAAGA ChrY:647038..647057 60.04 50
downstream ENSMUSE00000568510 ChrY:644294..644514 TGAATTGGCATTATCGGTTG ChrY:644429..644448 59.38 40
downstream ENSMUSE00000568509 ChrY:644123..644211 CTTGCCAGGAGTCCTCAAAC ChrY:644108..644127 59.84 55
downstream ENSMUSE00000568507 ChrY:641056..641212 CTGCAAGATCTGGTAGGCAAC ChrY:641034..641054 59.89 52.38
downstream ENSMUSE00000568505 ChrY:640729..640941 CATTCCATAGCCCAAGTCCA ChrY:640876..640895 60.85 50
downstream ENSMUSE00000568504 ChrY:639816..639911 ATGTTCATCGAGGGCATCTT ChrY:639857..639876 59.51 45
downstream ENSMUSE00000568502 ChrY:635404..635540 CTGAAAACGGCTGTTCAGGT ChrY:635491..635510 60.29 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGCAATAATCGCCTTGCAG ChrY:745901..745921 59.08 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGCAACGTGACTGGGAAA ChrY:745902..745922 58.92 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069044