Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34118
Trapped Gene
P2rx7 (ENSMUSG00000029468)
Vector Insertion
Chr 5: 123134307 - 123141261
Public Clones IST11163E2 (tigm) IST10814B9 (tigm) IST10814B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000719705 (Chr5:123133184..123134306 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGACCTCAGACGGATGACC Chr5:123133411..123133430 59.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000719705 (Chr5:123133184..123134306 +)
Downstram Exon
ENSMUSE00000649890 (Chr5:123141262..123141441 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGACCTCAGACGGATGACC Chr5:123133411..123133430 59.93 55 CGACCACTTGCTGTTTTTGA Chr5:123141424..123141443 59.88 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000537791 Chr5:123093920..123094207 TCCTAGGTGAGGGTTTGCTG Chr5:123094002..123094021 60.25 55
upstream ENSMUSE00000709731 Chr5:123093920..123094207 TCCTAGGTGAGGGTTTGCTG Chr5:123094002..123094021 60.25 55
upstream ENSMUSE00000330124 Chr5:123102736..123102904 AAGCTGTACCAGCGGAAAGA Chr5:123102755..123102774 60.01 50
upstream ENSMUSE00000189155 Chr5:123104170..123104238 AGTCAGAAGGCCAAGTGCAG Chr5:123104204..123104223 60.59 55
upstream ENSMUSE00000537763 Chr5:123104988..123105238 CTGCTGCCTCCTGGTAGTTC Chr5:123105091..123105110 60.01 60
upstream ENSMUSE00000189149 Chr5:123107021..123107093 TGTAAAAAGGGGTGGATGGA Chr5:123107060..123107079 60.16 45
upstream ENSMUSE00000189150 Chr5:123108717..123108813 TCTGCCTGGTGTCCTACTGA Chr5:123108773..123108792 59.42 55
upstream ENSMUSE00000189152 Chr5:123113586..123113666 GCCGAAAACTTCACCGTACT Chr5:123113605..123113624 59.24 50
upstream ENSMUSE00000410058 Chr5:123114554..123114683 CATCTTCCGACTAGGGGACA Chr5:123114620..123114639 60.06 55
upstream ENSMUSE00000338329 Chr5:123116153..123116289 GGGATTGCAACCTAGACAGC Chr5:123116181..123116200 59.7 55
upstream ENSMUSE00000381471 Chr5:123120447..123120537 TCCGTTTTGACATCCTGGTT Chr5:123120509..123120528 60.35 45
upstream ENSMUSE00000371551 Chr5:123123364..123123429 TTGGATCCACCCTGTCCTAC Chr5:123123401..123123420 59.78 55
upstream ENSMUSE00000330092 Chr5:123123675..123123824 TGTGTGCATTGACTTGCTCA Chr5:123123680..123123699 60.03 45
upstream ENSMUSE00000189148 Chr5:123126671..123126772 AGCTGCTTGGGAAAAGTCTG Chr5:123126726..123126745 59.62 50
upstream ENSMUSE00000649889 Chr5:123130816..123134293 ACTTAAGGTTTGCCCCTCGT Chr5:123131394..123131413 60 50
upstream ENSMUSE00000719705 Chr5:123133184..123134306 ATGACCTCAGACGGATGACC Chr5:123133411..123133430 59.93 55

*** Putative Vector Insertion (Chr 5: 123134307 - 123141261) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000649890 Chr5:123141262..123141441 CGACCACTTGCTGTTTTTGA Chr5:123141424..123141443 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr5:123140357..123140377 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGTTCACGTGACTGGGAAAA Chr5:123140351..123140372 60.14 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029468