Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34125
Trapped Gene
Elf1 (ENSMUSG00000036461)
Vector Insertion
Chr 14: 79881445 - 79915480
Public Clones IST12457B1 (tigm) IST14167F1 (tigm) IST11884E9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000512972 (Chr14:79881001..79881444 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCGGCTCAGAACTTTCCA Chr14:79881274..79881293 60.51 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000512972 (Chr14:79881001..79881444 +)
Downstram Exon
ENSMUSE00000647192 (Chr14:79915481..79915577 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCGGCTCAGAACTTTCCA Chr14:79881274..79881293 60.51 50 CTTCAGGTTTCGTCCTCTGG Chr14:79915566..79915585 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000512972 Chr14:79881001..79881444 CTTCGGCTCAGAACTTTCCA Chr14:79881274..79881293 60.51 50

*** Putative Vector Insertion (Chr 14: 79881445 - 79915480) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000647192 Chr14:79915481..79915577 CTTCAGGTTTCGTCCTCTGG Chr14:79915566..79915585 59.84 55
downstream ENSMUSE00000360302 Chr14:79935930..79936229 AAAAGGCCTAAGCAGCTTCC Chr14:79936130..79936149 59.99 50
downstream ENSMUSE00000295543 Chr14:79960554..79960734 TTCAGCAACATCCAATGAGC Chr14:79960694..79960713 59.81 45
downstream ENSMUSE00000295536 Chr14:79965269..79965379 GCAGCCTCAATGGTCTCAAT Chr14:79965323..79965342 60.23 50
downstream ENSMUSE00000554267 Chr14:79966957..79967121 TCTTTCTCTTGCGCTGCTCT Chr14:79967121..79967140 60.56 50
downstream ENSMUSE00000554263 Chr14:79969028..79969111 GTGTAGTCGTCGGGGAATCT Chr14:79969075..79969094 59.02 55
downstream ENSMUSE00000612853 Chr14:79970530..79970722 TCTCCCCATGGTCTCGTAGT Chr14:79970717..79970736 59.53 55
downstream ENSMUSE00000295500 Chr14:79972979..79973425 AGAATTCCCGGGCTTTAGAA Chr14:79973225..79973244 60.03 45
downstream ENSMUSE00000474019 Chr14:79979992..79982282 ACTTGGGTTCGCCTCCTTAT Chr14:79980736..79980755 59.96 50
downstream ENSMUSE00000647193 Chr14:79979992..79982283 ACTTGGGTTCGCCTCCTTAT Chr14:79980736..79980755 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTGTGTTTAATCGCCTTG Chr14:79896487..79896507 60.64 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCATCGTGACTGGGAAAA Chr14:79896490..79896510 61.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036461