Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34135
Trapped Gene
P42pop (ENSMUSG00000048481)
Vector Insertion
Chr 7: 19586658 - 19586731
Public Clones IST14682C6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000442224 (Chr7:19585840..19586657 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTTGCAATCCCCAAGAAG Chr7:19585895..19585914 59.81 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000442224 (Chr7:19585840..19586657 +)
Downstram Exon
ENSMUSE00000334311 (Chr7:19586732..19587112 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTTGCAATCCCCAAGAAG Chr7:19585895..19585914 59.81 50 AGGCAAAGGACCCAACCTAT Chr7:19587017..19587036 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000375506 Chr7:19576668..19576703 No primer for this exon
upstream ENSMUSE00000331959 Chr7:19577331..19577969 AGGCTTCGACCGCTAGTACA Chr7:19577904..19577923 60.04 55
upstream ENSMUSE00000442224 Chr7:19585840..19586657 CTCTTGCAATCCCCAAGAAG Chr7:19585895..19585914 59.81 50

*** Putative Vector Insertion (Chr 7: 19586658 - 19586731) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000334311 Chr7:19586732..19587112 AGGCAAAGGACCCAACCTAT Chr7:19587017..19587036 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCCTCAGCCCCTTTCTAA Chr7:19586692..19586712 60.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCCACTTCCTGTGCTAGTT Chr7:19586637..19586658 60.04 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048481