Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34137
Trapped Gene
AC105336.14 (ENSMUSG00000039887)
Vector Insertion
Chr 3: 120994902 - 121001521
Public Clones IST12247H3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000267044 (Chr3:120994691..120994901 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTCTTGATCGTGGCTGGAT Chr3:120994879..120994898 59.69 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000267044 (Chr3:120994691..120994901 +)
Downstram Exon
ENSMUSE00000267037 (Chr3:121001522..121001676 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTCTTGATCGTGGCTGGAT Chr3:120994879..120994898 59.69 50 TGGTGAATAGGCATTGGACA Chr3:121001583..121001602 59.92 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000267044 Chr3:120994691..120994901 ACTCTTGATCGTGGCTGGAT Chr3:120994879..120994898 59.69 50

*** Putative Vector Insertion (Chr 3: 120994902 - 121001521) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000267037 Chr3:121001522..121001676 TGGTGAATAGGCATTGGACA Chr3:121001583..121001602 59.92 45
downstream ENSMUSE00000516823 Chr3:121022998..121023129 GGAATTCGGTGAAGGTGGTA Chr3:121023029..121023048 59.79 50
downstream ENSMUSE00000587091 Chr3:121064474..121064936 CCTGACAGGGATAGCGTCTC Chr3:121064610..121064629 59.83 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGCTGGATCCGGTAAGTA Chr3:121000890..121000910 59.96 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGCTGGATCCGGTAAGTA Chr3:121000890..121000910 59.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039887