Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3415
Trapped Gene
OTTMUSG00000016321 (ENSMUSG00000078864)
Vector Insertion
Chr 2: 177497606 - 177502748
Public Clones AB0244 (sanger) (sanger) (sanger) RRU200 (baygenomics) 5SD074G01 (ggtc)
3SD074G01 (ggtc) IST11571E5 (tigm) IST14641H2 (tigm) IST14697A2 (tigm)
IST10461G9 (tigm)
Private Clones OST406491 (lexicon) OST373521 (lexicon) OST358509 (lexicon) OST355206 (lexicon)
OST321466 (lexicon) OST131544 (lexicon) OST40617 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714580 (Chr2:177497551..177497605 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714580 (Chr2:177497551..177497605 +)
Downstram Exon
ENSMUSE00000678572 (Chr2:177502749..177502875 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTCTGAGAAGGATGCAGCAA Chr2:177502825..177502844 59.67 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678574 Chr2:177493998..177494080 TGGGAGTTGTGAGAGGAGGT Chr2:177494035..177494054 59.68 55
upstream ENSMUSE00000714580 Chr2:177497551..177497605 No primer for this exon

*** Putative Vector Insertion (Chr 2: 177497606 - 177502748) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678572 Chr2:177502749..177502875 TTCTGAGAAGGATGCAGCAA Chr2:177502825..177502844 59.67 45
downstream ENSMUSE00000678571 Chr2:177503081..177503141 No primer for this exon
downstream ENSMUSE00000678569 Chr2:177504292..177505177 CCTGCATGTGTTCGCTTATG Chr2:177504735..177504754 60.28 50
downstream ENSMUSE00000678570 Chr2:177504292..177507393 CTGCACGGCTCTCAACATTA Chr2:177506706..177506725 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGTCCCACAAAGAGGAGGA Chr2:177497621..177497641 59.51 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTCCCACAAAGAGGAGGA Chr2:177497621..177497641 59.51 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078864