Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34156
Trapped Gene
Notch4 (ENSMUSG00000015468)
Vector Insertion
Chr 17: 34723620 - 34724061
Public Clones IST13549A9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000141124 (Chr17:34723472..34723619 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000141124 (Chr17:34723472..34723619 +)
Downstram Exon
ENSMUSE00000293910 (Chr17:34724062..34724159 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000294523 Chr17:34701240..34701454 No primer for this exon
upstream ENSMUSE00000141112 Chr17:34702246..34702327 No primer for this exon
upstream ENSMUSE00000141127 Chr17:34702418..34702713 No primer for this exon
upstream ENSMUSE00000141114 Chr17:34704287..34704634 No primer for this exon
upstream ENSMUSE00000141135 Chr17:34705109..34705231 No primer for this exon
upstream ENSMUSE00000141128 Chr17:34705338..34705574 No primer for this exon
upstream ENSMUSE00000141139 Chr17:34705662..34705817 No primer for this exon
upstream ENSMUSE00000141116 Chr17:34706980..34707174 No primer for this exon
upstream ENSMUSE00000141113 Chr17:34708682..34708795 No primer for this exon
upstream ENSMUSE00000141144 Chr17:34709441..34709554 No primer for this exon
upstream ENSMUSE00000141147 Chr17:34709623..34709745 No primer for this exon
upstream ENSMUSE00000141133 Chr17:34710694..34710853 No primer for this exon
upstream ENSMUSE00000141126 Chr17:34712008..34712153 No primer for this exon
upstream ENSMUSE00000141137 Chr17:34712352..34712504 No primer for this exon
upstream ENSMUSE00000141145 Chr17:34713354..34713471 No primer for this exon
upstream ENSMUSE00000141119 Chr17:34713714..34713801 No primer for this exon
upstream ENSMUSE00000141131 Chr17:34714363..34714513 No primer for this exon
upstream ENSMUSE00000141123 Chr17:34714893..34715077 No primer for this exon
upstream ENSMUSE00000141117 Chr17:34717865..34718117 No primer for this exon
upstream ENSMUSE00000141115 Chr17:34718324..34718436 No primer for this exon
upstream ENSMUSE00000141141 Chr17:34719344..34719867 No primer for this exon
upstream ENSMUSE00000294077 Chr17:34720295..34720678 No primer for this exon
upstream ENSMUSE00000141149 Chr17:34720774..34720949 No primer for this exon
upstream ENSMUSE00000141153 Chr17:34721357..34721576 No primer for this exon
upstream ENSMUSE00000141130 Chr17:34721726..34721795 No primer for this exon
upstream ENSMUSE00000141120 Chr17:34721936..34722074 No primer for this exon
upstream ENSMUSE00000141121 Chr17:34722850..34723154 No primer for this exon
upstream ENSMUSE00000141124 Chr17:34723472..34723619 No primer for this exon

*** Putative Vector Insertion (Chr 17: 34723620 - 34724061) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000293910 Chr17:34724062..34724159 No primer for this exon
downstream ENSMUSE00000293877 Chr17:34724319..34725476 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGTAAGGATAATCGCCTTG Chr17:34723662..34723682 59.56 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAGCGGTAAGGACGTGAC Chr17:34723657..34723677 59.87 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015468