Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34161
Trapped Gene
EG432723 (ENSMUSG00000053499)
Vector Insertion
Chr 13: 4770943 - 4832769
Public Clones IST14998G12 (tigm) IST11635E10 (tigm) IST14740G5 (tigm) IST12315F10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000434595 (Chr13:4770895..4770942 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAGTGCCTGGAGACTGTTGC Chr13:4770920..4770939 59.04 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000434595 (Chr13:4770895..4770942 +)
Downstram Exon
ENSMUSE00000434584 (Chr13:4832770..4832893 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAGTGCCTGGAGACTGTTGC Chr13:4770920..4770939 59.04 55 GAGACAGAGGGCCACTTCAA Chr13:4832806..4832825 60.39 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000434595 Chr13:4770895..4770942 TAGTGCCTGGAGACTGTTGC Chr13:4770920..4770939 59.04 55

*** Putative Vector Insertion (Chr 13: 4770943 - 4832769) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000434584 Chr13:4832770..4832893 GAGACAGAGGGCCACTTCAA Chr13:4832806..4832825 60.39 55
downstream ENSMUSE00000434586 Chr13:4833434..4835731 CCCATTGCAAACTGTCCTCT Chr13:4834390..4834409 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTATTCTGGGCGCACTGT Chr13:4827932..4827952 59.72 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTATTCTGGGCGCACTGT Chr13:4827932..4827952 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053499