Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34179
Trapped Gene
Pkia (ENSMUSG00000027499)
Vector Insertion
Chr 3: 7366753 - 7437337
Public Clones IST10465H2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000416373 (Chr3:7366604..7366752 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000416373 (Chr3:7366604..7366752 +)
Downstram Exon
ENSMUSE00000170104 (Chr3:7437338..7437515 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon ACTTGCAGAGGAAACCAGGA Chr3:7437463..7437482 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000416373 Chr3:7366604..7366752 No primer for this exon

*** Putative Vector Insertion (Chr 3: 7366753 - 7437337) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170104 Chr3:7437338..7437515 ACTTGCAGAGGAAACCAGGA Chr3:7437463..7437482 59.84 50
downstream ENSMUSE00000471631 Chr3:7442011..7445366 TTGTTCGGTGGAGCTTCTCT Chr3:7442051..7442070 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTCCTCTGCTAAGCCTCT Chr3:7393737..7393757 59.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCGTGACTTTTTCGTGAC Chr3:7393790..7393810 59.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027499