Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34194
Trapped Gene
Strc (ENSMUSG00000033498)
Vector Insertion
Chr 2: 121199285 - 121200148
Public Clones IST12393E2 (tigm) IST12378E8 (tigm) IST12002E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000293846 (Chr2:121200015..121200147 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGCCCTTGAGTGATCCAAT Chr2:121200079..121200098 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000293846 (Chr2:121200015..121200147 -)
Downstram Exon
ENSMUSE00000436494 (Chr2:121199286..121199468 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGCCCTTGAGTGATCCAAT Chr2:121200079..121200098 59.93 50 ACGCAACACTCCCAGAAGTT Chr2:121199417..121199436 59.77 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000387922 Chr2:121206541..121206676 CTGGCTATCCCTTCATGGTG Chr2:121206644..121206663 60.47 55
upstream ENSMUSE00000293913 Chr2:121204733..121205518 GCAGGTGTACTGGGTGGACT Chr2:121205164..121205183 60.03 60
upstream ENSMUSE00000293906 Chr2:121204622..121204646 No primer for this exon
upstream ENSMUSE00000293895 Chr2:121202378..121203755 GCTTGGCATGTTATCCCAGT Chr2:121202695..121202714 59.96 50
upstream ENSMUSE00000436532 Chr2:121201455..121201517 No primer for this exon
upstream ENSMUSE00000293878 Chr2:121201245..121201355 ACCTTCAGCAGCTTGTGCTT Chr2:121201311..121201330 60.2 50
upstream ENSMUSE00000293868 Chr2:121200935..121201101 TATCGACATGTCACCGCTCA Chr2:121200999..121201018 61.27 50
upstream ENSMUSE00000293858 Chr2:121200609..121200795 ATCAGGGATCACAGCTCAGG Chr2:121200766..121200785 60.22 55
upstream ENSMUSE00000293852 Chr2:121200394..121200509 AAACCAGAGCATGGAGGATG Chr2:121200413..121200432 60.07 50
upstream ENSMUSE00000293846 Chr2:121200015..121200147 GTGCCCTTGAGTGATCCAAT Chr2:121200079..121200098 59.93 50
upstream ENSMUSE00000436494 Chr2:121199286..121199468 GAGTGTTGCGTTCATCTGGA Chr2:121199430..121199449 59.84 50

*** Putative Vector Insertion (Chr 2: 121199285 - 121200148) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000436486 Chr2:121198997..121199035 AAGGAGCCTTCCAAACAACA Chr2:121198987..121199006 59.71 45
downstream ENSMUSE00000293823 Chr2:121198655..121198822 CAGAGTTCCTCCAGGGACAG Chr2:121198781..121198800 59.83 60
downstream ENSMUSE00000436237 Chr2:121198397..121198462 CACCTGCTGCACCCATATTT Chr2:121198404..121198423 60.91 50
downstream ENSMUSE00000399453 Chr2:121197819..121197938 AGAGTCTTCGGTTTGCCAGA Chr2:121197826..121197845 59.99 50
downstream ENSMUSE00000293796 Chr2:121197463..121197521 GGTTGGTAGGCACTTGCATT Chr2:121197460..121197479 60 50
downstream ENSMUSE00000293784 Chr2:121196675..121196798 AGGCTCTCTCGAACACCAGT Chr2:121196654..121196673 59.05 55
downstream ENSMUSE00000293769 Chr2:121196453..121196565 GTCATCCTCCGCTGTAGCTC Chr2:121196506..121196525 59.98 60
downstream ENSMUSE00000293761 Chr2:121194661..121194796 TCCACCACCAACATAATGGA Chr2:121194724..121194743 59.62 45
downstream ENSMUSE00000293748 Chr2:121194072..121194268 TATTCCCAGGAATCCAACCA Chr2:121194175..121194194 60.13 45
downstream ENSMUSE00000293739 Chr2:121193825..121193915 GCGTCCAGCTTGCTCTATTT Chr2:121193848..121193867 59.62 50
downstream ENSMUSE00000293732 Chr2:121193334..121193490 CTCCCAGCTTTGATGCTTTC Chr2:121193412..121193431 59.96 50
downstream ENSMUSE00000293724 Chr2:121192334..121192503 TGAGATTTGTGTCGCAGACC Chr2:121192414..121192433 59.84 50
downstream ENSMUSE00000293712 Chr2:121191479..121191634 GATCTGCTCAGGACGGAATC Chr2:121191574..121191593 59.77 55
downstream ENSMUSE00000293700 Chr2:121190757..121190899 TGTAACTCCTCTGGTCGCAAT Chr2:121190759..121190779 59.75 47.62
downstream ENSMUSE00000293692 Chr2:121190442..121190590 ATGCAAGCTACCCAGGAAGA Chr2:121190538..121190557 59.84 50
downstream ENSMUSE00000293683 Chr2:121190248..121190345 AGAGGAGTCAGGCCTTGGAT Chr2:121190260..121190279 60.22 55
downstream ENSMUSE00000293674 Chr2:121190009..121190156 CCTGACCCCTGGTGAGACTA Chr2:121190089..121190108 60.1 60
downstream ENSMUSE00000341396 Chr2:121189463..121189800 ATAGGTGGCCAAAAATGCTG Chr2:121189695..121189714 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr2:121200078..121200098 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTGCGTGACTGGGAAAAC Chr2:121200082..121200102 60.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033498