Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34196
Trapped Gene
Piwil4 (ENSMUSG00000036912)
Vector Insertion
Chr 9: 14534318 - 14539102
Public Clones IST12253E7 (tigm) IST12253E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000309783 (Chr9:14538887..14539101 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATACCTGTGCGGCTGGTTAC Chr9:14539071..14539090 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000309783 (Chr9:14538887..14539101 -)
Downstram Exon
ENSMUSE00000309762 (Chr9:14534319..14534440 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATACCTGTGCGGCTGGTTAC Chr9:14539071..14539090 60.02 55 AGCTTGCTCGTTAGGGTGAG Chr9:14534348..14534367 59.64 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000389420 Chr9:14544902..14545177 ACAGCCACACCGTCTCTTTT Chr9:14545052..14545071 59.77 50
upstream ENSMUSE00000703697 Chr9:14544902..14545151 ACAGCCACACCGTCTCTTTT Chr9:14545052..14545071 59.77 50
upstream ENSMUSE00000403337 Chr9:14543835..14543898 GGAGGTGGGACAAGTGTCAT Chr9:14543846..14543865 59.82 55
upstream ENSMUSE00000358105 Chr9:14541254..14541385 GGGAAAAGTTGACCCACGTA Chr9:14541270..14541289 59.83 50
upstream ENSMUSE00000309783 Chr9:14538887..14539101 ATACCTGTGCGGCTGGTTAC Chr9:14539071..14539090 60.02 55
upstream ENSMUSE00000309762 Chr9:14534319..14534440 CAAACTCCCCTGTGTGCATT Chr9:14534345..14534364 60.95 50

*** Putative Vector Insertion (Chr 9: 14534318 - 14539102) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000310087 Chr9:14533088..14533168 TGAGGGATCTCCACTGGTTC Chr9:14533072..14533091 60.05 55
downstream ENSMUSE00000364441 Chr9:14531773..14531922 CTCATTGCGGAGGACTTTGT Chr9:14531852..14531871 60.26 50
downstream ENSMUSE00000703696 Chr9:14531773..14531970 CTCATTGCGGAGGACTTTGT Chr9:14531852..14531871 60.26 50
downstream ENSMUSE00000310425 Chr9:14530309..14530420 GTGTGGGCTTCACAGACCAG Chr9:14530343..14530362 61.76 60
downstream ENSMUSE00000310408 Chr9:14524481..14524604 CAAGCACTGGCTGATTTAGGT Chr9:14524540..14524560 59.39 47.62
downstream ENSMUSE00000310390 Chr9:14522680..14522797 CTTCATCAGGCGGAAATCTG Chr9:14522735..14522754 60.73 50
downstream ENSMUSE00000703693 Chr9:14522680..14522917 AGTAAGCTGACCCCATGCAG Chr9:14522861..14522880 60.28 55
downstream ENSMUSE00000380059 Chr9:14520465..14520654 TGCTAAGTCCTCCTGGCTCT Chr9:14520556..14520575 59.19 55
downstream ENSMUSE00000703695 Chr9:14520172..14520283 CCCAGGTCTCAAGCTCAAAC Chr9:14520227..14520246 59.84 55
downstream ENSMUSE00000310358 Chr9:14519287..14519471 CTCAGCCCTGTTACAGCACA Chr9:14519342..14519361 60.05 55
downstream ENSMUSE00000309668 Chr9:14516714..14516786 TGGGGTCTCGTCCACTTTTA Chr9:14516743..14516762 60.49 50
downstream ENSMUSE00000310318 Chr9:14514356..14514556 CTTATTCAAGGTCCGGGTCA Chr9:14514421..14514440 59.93 50
downstream ENSMUSE00000354588 Chr9:14513306..14513409 TCAATACCCACGACCATCAG Chr9:14513359..14513378 59.37 50
downstream ENSMUSE00000310252 Chr9:14510653..14510723 GACTTTGAGGCAATCTGCAA Chr9:14510641..14510660 59 45
downstream ENSMUSE00000310022 Chr9:14509350..14509503 CGTCCCGGTACACGACTATC Chr9:14509416..14509435 60.4 60
downstream ENSMUSE00000309991 Chr9:14508083..14508169 TGTGGTCAGTCGAAGCAAAG Chr9:14508070..14508089 60.03 50
downstream ENSMUSE00000310206 Chr9:14508034..14508080 CGGACGTGTTGCTTCTGAGT Chr9:14508017..14508036 61.45 55
downstream ENSMUSE00000703694 Chr9:14508034..14508162 TGTGGTCAGTCGAAGCAAAG Chr9:14508070..14508089 60.03 50
downstream ENSMUSE00000310187 Chr9:14507469..14507616 ACGTTGTAGTGGGTGGGACT Chr9:14507529..14507548 59.35 55
downstream ENSMUSE00000710170 Chr9:14506802..14506918 TCCTTGTGGACACTTTGTGC Chr9:14506820..14506839 59.73 50
downstream ENSMUSE00000717017 Chr9:14506802..14506918 TCCTTGTGGACACTTTGTGC Chr9:14506820..14506839 59.73 50
downstream ENSMUSE00000703692 Chr9:14506223..14506918 GCAGATCTGAACAACGCAGA Chr9:14506718..14506737 60.14 50
downstream ENSMUSE00000428283 Chr9:14504640..14504717 AGGTTTTAGAGCAGCCTGGA Chr9:14504663..14504682 59.08 50
downstream ENSMUSE00000703701 Chr9:14500674..14502343 CACAGTCACGATGTCGCTTT Chr9:14502252..14502271 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATAATCGCCTTGCAGCAC Chr9:14536034..14536054 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTTTCAGAGCACGAAACC Chr9:14536072..14536092 58.08 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036912