Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34197
Trapped Gene
Hoxb2 (ENSMUSG00000075588)
Vector Insertion
Chr 11: 96213510 - 96214263
Public Clones IST12503C8 (tigm) IST12309H2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000648486 (Chr11:96212946..96213509 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCACCCTTCAGAGACCAG Chr11:96213304..96213323 59.83 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000648486 (Chr11:96212946..96213509 +)
Downstram Exon
ENSMUSE00000648485 (Chr11:96214264..96215330 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCACCCTTCAGAGACCAG Chr11:96213304..96213323 59.83 60 GCAGCGAAGAAATTGAGGTC Chr11:96214810..96214829 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000648486 Chr11:96212946..96213509 CTCCACCCTTCAGAGACCAG Chr11:96213304..96213323 59.83 60

*** Putative Vector Insertion (Chr 11: 96213510 - 96214263) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000648485 Chr11:96214264..96215330 GCAGCGAAGAAATTGAGGTC Chr11:96214810..96214829 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAAGAGAAGGGGTAATCG Chr11:96213547..96213567 59.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCATCAGGTGGGTAAACG Chr11:96213502..96213522 61.2 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075588