Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34208
Trapped Gene
Ret (ENSMUSG00000030110)
Vector Insertion
Chr 6: 118119850 - 118123687
Public Clones IST14679H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000195389 (Chr6:118123433..118123686 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGGGCTTCCCAATCAGTTA Chr6:118123509..118123528 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000195389 (Chr6:118123433..118123686 -)
Downstram Exon
ENSMUSE00000303692 (Chr6:118119851..118119998 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGGGCTTCCCAATCAGTTA Chr6:118123509..118123528 60.07 50 GCTGTGGCCTTGACAACTTT Chr6:118119885..118119904 60.3 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000460847 Chr6:118147079..118147762 AGCGCAGGTCTCTCATCAGT Chr6:118147343..118147362 60.17 55
upstream ENSMUSE00000195395 Chr6:118134195..118134458 GGATCCGCATCAATGAGACT Chr6:118134259..118134278 60.04 50
upstream ENSMUSE00000195391 Chr6:118131843..118132130 GGCACCTTCTACCACTTCCA Chr6:118131902..118131921 60.11 55
upstream ENSMUSE00000195394 Chr6:118130236..118130480 TGGTGGAGTTTAAGCGGAAG Chr6:118130239..118130258 60.24 50
upstream ENSMUSE00000195392 Chr6:118129290..118129485 CAGGTGTTCGATGCAGATGT Chr6:118129445..118129464 59.71 50
upstream ENSMUSE00000195390 Chr6:118128483..118128685 CAGGTGGTATCCTCGTCCTC Chr6:118128573..118128592 59.53 60
upstream ENSMUSE00000195397 Chr6:118126196..118126454 CTGAGTGCACCAAGCTTCAG Chr6:118126272..118126291 59.77 55
upstream ENSMUSE00000195387 Chr6:118125741..118125866 AGAAGTAGGCTGCCCCAAGT Chr6:118125837..118125856 60.27 55
upstream ENSMUSE00000195393 Chr6:118125025..118125135 CAGGAACTTCTCCACCTGCT Chr6:118125109..118125128 59.45 55
upstream ENSMUSE00000195388 Chr6:118124255..118124374 TAAAGCAGGCTACGGCATCT Chr6:118124309..118124328 60 50
upstream ENSMUSE00000195389 Chr6:118123433..118123686 CAGGGCTTCCCAATCAGTTA Chr6:118123509..118123528 60.07 50
upstream ENSMUSE00000303692 Chr6:118119851..118119998 AAAGTTGTCAAGGCCACAGC Chr6:118119907..118119926 60.3 50

*** Putative Vector Insertion (Chr 6: 118119850 - 118123687) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000195704 Chr6:118119140..118119247 GAACTCAGACAGCAGGTCTCG Chr6:118119182..118119202 60.19 57.14
downstream ENSMUSE00000693415 Chr6:118118140..118118354 GGTCACCCATGGTCAGTACC Chr6:118118174..118118193 60.1 60
downstream ENSMUSE00000195699 Chr6:118117914..118118036 CCCAAAGTCGGAAATCTTCA Chr6:118117940..118117959 60.04 45
downstream ENSMUSE00000554406 Chr6:118115928..118115998 TGTGATCGAAAAGGGACTCA Chr6:118115928..118115947 59.22 45
downstream ENSMUSE00000195701 Chr6:118114741..118114878 CAGTTGTCTGGCCTCTCCAT Chr6:118114731..118114750 60.26 55
downstream ENSMUSE00000303659 Chr6:118113206..118113305 GTCAGCAAACACTGGCCTCT Chr6:118113223..118113242 60.45 55
downstream ENSMUSE00000303649 Chr6:118105306..118105453 GTGAGTCCGAAGGTGTGGAT Chr6:118105392..118105411 59.97 55
downstream ENSMUSE00000303641 Chr6:118101766..118104028 TGGTGGCTAGTGATGAGCAG Chr6:118103542..118103561 60.01 55
downstream ENSMUSE00000611743 Chr6:118101766..118105453 TGGTGGCTAGTGATGAGCAG Chr6:118103542..118103561 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATCATCACAGCTGCCCTCT Chr6:118120637..118120657 60.38 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTCGTGACTGGGAAAACC Chr6:118120620..118120640 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030110