Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34209
Trapped Gene
Dlgap1 (ENSMUSG00000003279)
Vector Insertion
Chr 17: 71165434 - 71167364
Public Clones IST11803F6 (tigm) IST10866A7 (tigm) IST10221H2 (tigm) IST10041G11 (tigm)
IST11229C8 (tigm) IST14801H8 (tigm) IST14102G4 (tigm) IST14801H8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000692631 (Chr17:71164534..71165433 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000692631 (Chr17:71164534..71165433 +)
Downstram Exon
ENSMUSE00000657023 (Chr17:71167365..71169064 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411615 Chr17:70318586..70319010 No primer for this exon
upstream ENSMUSE00000692672 Chr17:70427602..70427763 No primer for this exon
upstream ENSMUSE00000692665 Chr17:70555577..70555685 No primer for this exon
upstream ENSMUSE00000692663 Chr17:70657387..70657510 No primer for this exon
upstream ENSMUSE00000692659 Chr17:70774136..70774228 No primer for this exon
upstream ENSMUSE00000369734 Chr17:70865294..70866336 No primer for this exon
upstream ENSMUSE00000692632 Chr17:70911127..70911211 No primer for this exon
upstream ENSMUSE00000422422 Chr17:70942507..70942721 No primer for this exon
upstream ENSMUSE00000422417 Chr17:71006794..71006971 No primer for this exon
upstream ENSMUSE00000354741 Chr17:71011909..71012149 No primer for this exon
upstream ENSMUSE00000399544 Chr17:71067536..71067565 No primer for this exon
upstream ENSMUSE00000361534 Chr17:71110415..71110785 No primer for this exon
upstream ENSMUSE00000407470 Chr17:71115338..71115429 No primer for this exon
upstream ENSMUSE00000348253 Chr17:71136128..71136549 No primer for this exon
upstream ENSMUSE00000353149 Chr17:71158528..71158619 No primer for this exon
upstream ENSMUSE00000137561 Chr17:71164534..71164686 No primer for this exon
upstream ENSMUSE00000692631 Chr17:71164534..71165433 No primer for this exon

*** Putative Vector Insertion (Chr 17: 71165434 - 71167364) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000657023 Chr17:71167365..71169064 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr17:71165483..71165503 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCACGCTTTTACGTGACTG Chr17:71165473..71165493 58.85 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003279