Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34250
Trapped Gene
H3f3b (ENSMUSG00000016559)
Vector Insertion
Chr 11: 115886618 - 115889277
Public Clones IST12320G6 (tigm) IST12320G6 (tigm) IST10497F3 (tigm) IST14516C9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000669979 (Chr11:115889170..115889276 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000669979 (Chr11:115889170..115889276 -)
Downstram Exon
ENSMUSE00000669978 (Chr11:115886619..115886769 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669979 Chr11:115889170..115889276 No primer for this exon
upstream ENSMUSE00000669978 Chr11:115886619..115886769 No primer for this exon

*** Putative Vector Insertion (Chr 11: 115886618 - 115889277) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000109009 Chr11:115885693..115885813 No primer for this exon
downstream ENSMUSE00000669977 Chr11:115885693..115886032 No primer for this exon
downstream ENSMUSE00000109012 Chr11:115885196..115885333 No primer for this exon
downstream ENSMUSE00000711222 Chr11:115885196..115885333 No primer for this exon
downstream ENSMUSE00000496619 Chr11:115884939..115885092 No primer for this exon
downstream ENSMUSE00000705782 Chr11:115883607..115884849 No primer for this exon
downstream ENSMUSE00000373775 Chr11:115883226..115884849 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACAGAACAACAGTCCCGATG Chr11:115889235..115889256 60.02 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACAGAACAACAGTCCCGATG Chr11:115889235..115889256 60.02 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000016559