Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34265
Trapped Gene
Gaa (ENSMUSG00000025579)
Vector Insertion
Chr 11: 119129537 - 119131401
Public Clones IST14216A10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000705712 (Chr11:119129347..119129536 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGTCAGCGAGTTCCTGCT Chr11:119129486..119129505 60.21 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000705712 (Chr11:119129347..119129536 +)
Downstram Exon
ENSMUSE00000151834 (Chr11:119131402..119131992 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGTCAGCGAGTTCCTGCT Chr11:119129486..119129505 60.21 55 GTGGTGAGGTCGGTACGTCT Chr11:119131620..119131639 60.03 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669240 Chr11:119129340..119129405 No primer for this exon
upstream ENSMUSE00000585325 Chr11:119129342..119129536 ACTGTCAGCGAGTTCCTGCT Chr11:119129486..119129505 60.21 55
upstream ENSMUSE00000705712 Chr11:119129347..119129536 ACTGTCAGCGAGTTCCTGCT Chr11:119129486..119129505 60.21 55

*** Putative Vector Insertion (Chr 11: 119129537 - 119131401) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151834 Chr11:119131402..119131992 GTGGTGAGGTCGGTACGTCT Chr11:119131620..119131639 60.03 60
downstream ENSMUSE00000715903 Chr11:119131402..119131992 GTGGTGAGGTCGGTACGTCT Chr11:119131620..119131639 60.03 60
downstream ENSMUSE00000669238 Chr11:119131772..119131992 GACGGTAGCTTGGGTAGCTG Chr11:119131861..119131880 59.9 60
downstream ENSMUSE00000151850 Chr11:119134184..119134329 ACGAACGATCACTCCAAAGG Chr11:119134309..119134328 60.11 50
downstream ENSMUSE00000669237 Chr11:119134184..119134329 ACGAACGATCACTCCAAAGG Chr11:119134309..119134328 60.11 50
downstream ENSMUSE00000669239 Chr11:119134184..119134766 ACGAACGATCACTCCAAAGG Chr11:119134309..119134328 60.11 50
downstream ENSMUSE00000151840 Chr11:119135289..119135454 AGGAACTGGTCAGCGAAGAA Chr11:119135336..119135355 59.99 50
downstream ENSMUSE00000669236 Chr11:119135289..119135454 AGGAACTGGTCAGCGAAGAA Chr11:119135336..119135355 59.99 50
downstream ENSMUSE00000151839 Chr11:119135529..119135625 ATGTGACCCGTAGAGGTTGG Chr11:119135558..119135577 59.84 55
downstream ENSMUSE00000669235 Chr11:119135529..119135625 ATGTGACCCGTAGAGGTTGG Chr11:119135558..119135577 59.84 55
downstream ENSMUSE00000151851 Chr11:119135955..119136074 ATTGTTGCACAACGCTCTTG Chr11:119136062..119136081 59.91 45
downstream ENSMUSE00000151845 Chr11:119136170..119136288 GGGAAGTGTGTCCTGGTCAT Chr11:119136287..119136306 59.82 55
downstream ENSMUSE00000151836 Chr11:119136374..119136505 AGTCCAGGTCATTCCATTGC Chr11:119136401..119136420 59.93 50
downstream ENSMUSE00000669233 Chr11:119136650..119136718 GGCTTTAAGGCAGAGCAGTT Chr11:119136685..119136704 58.74 50
downstream ENSMUSE00000151849 Chr11:119138156..119138266 CTCGTCGTAGGGCCTGTAAC Chr11:119138212..119138231 59.76 60
downstream ENSMUSE00000151842 Chr11:119138815..119138928 AGTCAAGGGTCTCAGGGTTG Chr11:119138872..119138891 59.15 55
downstream ENSMUSE00000151844 Chr11:119139008..119139092 AAGTTGGACGGTTCGTTCAT Chr11:119139033..119139052 59.45 45
downstream ENSMUSE00000151841 Chr11:119139579..119139696 AGTGAGGCCGTACAGGTTGT Chr11:119139679..119139698 59.65 55
downstream ENSMUSE00000151848 Chr11:119140190..119140323 ATCACAAAGGGTCGTGTTCC Chr11:119140231..119140250 59.83 50
downstream ENSMUSE00000151838 Chr11:119141726..119141877 TCTCCTATGAAGCCGCAGAT Chr11:119141795..119141814 59.94 50
downstream ENSMUSE00000151837 Chr11:119142427..119142575 GCAGAAGGGCATAGCGTAAG Chr11:119142508..119142527 60 55
downstream ENSMUSE00000151835 Chr11:119144488..119144629 AGCACAGGTGTGATGAGCAG Chr11:119144568..119144587 60.06 55
downstream ENSMUSE00000151846 Chr11:119144974..119145126 GTACCGAGGGAATCCACTGA Chr11:119144999..119145018 59.93 55
downstream ENSMUSE00000151843 Chr11:119145373..119145537 CTGTTAATGCCACAGCCAGA Chr11:119145439..119145458 59.86 50
downstream ENSMUSE00000151832 Chr11:119145761..119145913 CTCCTTGGTCACACGCACTA Chr11:119145802..119145821 59.9 55
downstream ENSMUSE00000364002 Chr11:119146319..119146768 GAAACAGCTCTCCCATCAGC Chr11:119146364..119146383 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000025579