Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34279
Trapped Gene
D030016E14Rik (ENSMUSG00000038102)
Vector Insertion
Chr 8: 48589235 - 48590837
Public Clones IST13304D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000266672 (Chr8:48590688..48590836 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCAGTCCCACGAGAAGTCC Chr8:48590728..48590747 60.24 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000266672 (Chr8:48590688..48590836 -)
Downstram Exon
ENSMUSE00000266661 (Chr8:48589236..48589357 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCAGTCCCACGAGAAGTCC Chr8:48590728..48590747 60.24 55 GGTGTAGGTCTCCCACAGGA Chr8:48589225..48589244 59.96 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000438980 Chr8:48618673..48618824 AGGAAGTGTCGCCTTCTGTC Chr8:48618804..48618823 59.46 55
upstream ENSMUSE00000438959 Chr8:48616006..48616231 CCGGGTACCAATTTCTTTCA Chr8:48616050..48616069 59.79 45
upstream ENSMUSE00000499067 Chr8:48614683..48614852 CTTAAAGACGGGCTGGATGA Chr8:48614798..48614817 60.21 50
upstream ENSMUSE00000438948 Chr8:48613314..48613384 TGCAGTCGTCCTGATTCAAA Chr8:48613335..48613354 60.39 45
upstream ENSMUSE00000438943 Chr8:48612294..48612408 GACCACCTTGTGGGCTACAT Chr8:48612300..48612319 59.85 55
upstream ENSMUSE00000438938 Chr8:48610325..48610424 TGAGCATGCCCAGACCTATT Chr8:48610387..48610406 60.62 50
upstream ENSMUSE00000504994 Chr8:48609879..48609952 No primer for this exon
upstream ENSMUSE00000496412 Chr8:48607705..48607801 TGAGGGCCCATGAAACTAAT Chr8:48607747..48607766 59.39 45
upstream ENSMUSE00000494595 Chr8:48604926..48605059 GGATGCGATTGCTCAGTTTC Chr8:48605005..48605024 60.75 50
upstream ENSMUSE00000266774 Chr8:48601813..48601960 GCAGCTTACTATGCCCAGGA Chr8:48601850..48601869 60.37 55
upstream ENSMUSE00000266770 Chr8:48600138..48600231 ACACAATCAGGCGTTCTTGA Chr8:48600176..48600195 59.29 45
upstream ENSMUSE00000266764 Chr8:48599405..48599484 TCTCGGACCCTGAGAAAGAG Chr8:48599456..48599475 59.53 55
upstream ENSMUSE00000607901 Chr8:48599235..48599313 No primer for this exon
upstream ENSMUSE00000607900 Chr8:48599108..48599162 TGGTTCAGATGGGAGAGGAG Chr8:48599143..48599162 60.19 55
upstream ENSMUSE00000607899 Chr8:48598637..48598782 GACGACAGCCCTGAAGTGTT Chr8:48598697..48598716 60.31 55
upstream ENSMUSE00000266726 Chr8:48597915..48597976 TGAAAGATGAGCAGAAGTCTCG Chr8:48597946..48597967 59.76 45.46
upstream ENSMUSE00000266715 Chr8:48597690..48597822 TGACCCTGAACCTGACTGTG Chr8:48597792..48597811 59.71 55
upstream ENSMUSE00000266705 Chr8:48596225..48596355 TGTCCACACCCCATTAGGTT Chr8:48596256..48596275 60.09 50
upstream ENSMUSE00000709053 Chr8:48596225..48596702 CCATGGGGTCGTAAGAAAGA Chr8:48596558..48596577 59.93 50
upstream ENSMUSE00000266696 Chr8:48592935..48593090 TTAGTTCCCGGCAAAACAAG Chr8:48592990..48593009 60.1 45
upstream ENSMUSE00000266685 Chr8:48590940..48591127 AGCGTCATAATCCAGGCAAG Chr8:48590946..48590965 60.24 50
upstream ENSMUSE00000266672 Chr8:48590688..48590836 TTCAGTCCCACGAGAAGTCC Chr8:48590728..48590747 60.24 55
upstream ENSMUSE00000717592 Chr8:48589599..48590836 ACTGGAGAGCCGTCTTTGAA Chr8:48590072..48590091 59.99 50
upstream ENSMUSE00000266661 Chr8:48589236..48589357 TCCTGTGGGAGACCTACACC Chr8:48589247..48589266 59.96 60

*** Putative Vector Insertion (Chr 8: 48589235 - 48590837) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000266654 Chr8:48588666..48588785 CACTGTTCCACAGCGAACAT Chr8:48588728..48588747 59.75 50
downstream ENSMUSE00000266651 Chr8:48587162..48587227 CTGACTGCGACATCAAATGG Chr8:48587156..48587175 60.26 50
downstream ENSMUSE00000266648 Chr8:48586907..48587063 TCTGGGACTCCAGATGATCC Chr8:48586894..48586913 60.01 55
downstream ENSMUSE00000498530 Chr8:48584008..48584119 GTAATGTCCCGTTGCCACTC Chr8:48584003..48584022 60.38 55
downstream ENSMUSE00000582367 Chr8:48582273..48582364 GTTCACGTGGAGAGGGATGT Chr8:48582255..48582274 59.97 55
downstream ENSMUSE00000582366 Chr8:48580357..48580490 CGACTCTCTGACACGTCCAA Chr8:48580437..48580456 60.02 55
downstream ENSMUSE00000520093 Chr8:48578593..48578760 AGCAGCTGGTTGGTGAAGTT Chr8:48578605..48578624 59.91 50
downstream ENSMUSE00000510673 Chr8:48575483..48576272 CCCGCAGTCTGCATAGTACA Chr8:48575509..48575528 59.89 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTACCGCTGCTCTCTAAGC Chr8:48590862..48590882 60.31 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTACCGCTGCTCTCTAAGC Chr8:48590862..48590882 60.31 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038102