Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34281
Trapped Gene
EG432637 (ENSMUSG00000073168)
Vector Insertion
Chr 12: 22186357 - 22212307
Public Clones IST11713G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000655693 (Chr12:22212181..22212306 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCGGAATTCATAGCCGAGA Chr12:22212267..22212286 60.18 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000655693 (Chr12:22212181..22212306 -)
Downstram Exon
ENSMUSE00000655689 (Chr12:22186358..22186484 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCGGAATTCATAGCCGAGA Chr12:22212267..22212286 60.18 50 GAAGGATCCAGCAAATTCCA Chr12:22186395..22186414 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000686136 Chr12:22324248..22324391 TTTGCAGAGGACTTGATAGCTG Chr12:22324320..22324341 59.65 45.46
upstream ENSMUSE00000655693 Chr12:22212181..22212306 GTCGGAATTCATAGCCGAGA Chr12:22212267..22212286 60.18 50
upstream ENSMUSE00000686134 Chr12:22212181..22212414 GTCGGAATTCATAGCCGAGA Chr12:22212267..22212286 60.18 50
upstream ENSMUSE00000655689 Chr12:22186358..22186484 GGGAAGAGTGGAATTTGCTG Chr12:22186425..22186444 59.67 50

*** Putative Vector Insertion (Chr 12: 22186357 - 22212307) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000655687 Chr12:22186097..22186157 No primer for this exon
downstream ENSMUSE00000655685 Chr12:22179451..22179493 AAAGGCATTTTGGAAACCTG Chr12:22179438..22179457 59.06 40
downstream ENSMUSE00000686143 Chr12:22179305..22179493 CATTTCTCAGTCCCCCACTG Chr12:22179365..22179384 60.5 55
downstream ENSMUSE00000686139 Chr12:22171708..22173772 CCGAGCACAACTTCTCTTCC Chr12:22172437..22172456 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAGCCGAGACCCTTGAGGT Chr12:22212255..22212275 60.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCAAGAGGGCTCAACAGTG Chr12:22212260..22212280 60.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073168