Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34307
Trapped Gene
Mamdc2 (ENSMUSG00000033207)
Vector Insertion
Chr 19: 23408480 - 23425355
Public Clones IST11108D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000397985 (Chr19:23425089..23425354 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGCAAGCGGAAATCAGTT Chr19:23425112..23425131 60.22 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000397985 (Chr19:23425089..23425354 -)
Downstram Exon
ENSMUSE00000363746 (Chr19:23408481..23408574 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGCAAGCGGAAATCAGTT Chr19:23425112..23425131 60.22 45 GACCGGCAGTTTCCTAGTTG Chr19:23408464..23408483 59.73 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000332948 Chr19:23522515..23522888 TAGAAGGGGTCCTGCTGGTA Chr19:23522522..23522541 59.69 55
upstream ENSMUSE00000382692 Chr19:23522070..23522183 GACTCCGTGTTTGCGTTTCT Chr19:23522093..23522112 60.3 50
upstream ENSMUSE00000349008 Chr19:23453153..23453424 ACTGTTTGCGCCTGGTCTAC Chr19:23453318..23453337 60.32 55
upstream ENSMUSE00000349185 Chr19:23451756..23451840 AAGATGACAGCCGGCTACTG Chr19:23451761..23451780 60.42 55
upstream ENSMUSE00000384080 Chr19:23448408..23448545 CCAATGTGAACTGGTTCGTG Chr19:23448475..23448494 60 50
upstream ENSMUSE00000350017 Chr19:23438200..23438456 TGTTTACACACGGGACATGG Chr19:23438295..23438314 60.28 50
upstream ENSMUSE00000357909 Chr19:23433640..23433733 CTTTCAATGGTCCCAAAGGA Chr19:23433698..23433717 59.9 45
upstream ENSMUSE00000389882 Chr19:23427794..23427937 GCTGCGATTTTGAGATAGGC Chr19:23427891..23427910 59.95 50
upstream ENSMUSE00000397985 Chr19:23425089..23425354 GATGCAAGCGGAAATCAGTT Chr19:23425112..23425131 60.22 45
upstream ENSMUSE00000363746 Chr19:23408481..23408574 AGCCCTGGATGACATTACCA Chr19:23408508..23408527 60.34 50

*** Putative Vector Insertion (Chr 19: 23408480 - 23425355) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000250116 Chr19:23405376..23405528 GCTTCGGTTCCTTTTCTCCT Chr19:23405427..23405446 59.83 50
downstream ENSMUSE00000250096 Chr19:23385252..23385511 CCCCTTCTTCTCCACAACAG Chr19:23385291..23385310 59.69 55
downstream ENSMUSE00000250065 Chr19:23378302..23378386 ACTCCTCGAGTGGCTTCAAA Chr19:23378339..23378358 59.99 50
downstream ENSMUSE00000402469 Chr19:23377242..23378176 GCCTTGTTGAAAAGGTGCAT Chr19:23377450..23377469 60.12 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr19:23413285..23413305 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCCTCACAGGGCACTACC Chr19:23425344..23425364 60.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033207