Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34310
Trapped Gene
Ghrh (ENSMUSG00000027643)
Vector Insertion
Chr 2: 157163091 - 157172392
Public Clones IST12881A12 (tigm) IST12905B3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000411777 (Chr2:157172308..157172391 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000411777 (Chr2:157172308..157172391 -)
Downstram Exon
ENSMUSE00000680658 (Chr2:157163092..157163162 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTCTCCGATTGAGGTTCTGC Chr2:157163090..157163109 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411777 Chr2:157172308..157172391 No primer for this exon
upstream ENSMUSE00000680658 Chr2:157163092..157163162 GCAGAACCTCAATCGGAGAG Chr2:157163112..157163131 59.95 55

*** Putative Vector Insertion (Chr 2: 157163091 - 157172392) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000316867 Chr2:157159429..157159528 TGGTGAGGATGAGGATCACA Chr2:157159447..157159466 60.05 50
downstream ENSMUSE00000171437 Chr2:157159114..157159215 ATCACTTTCCGGGCATACAG Chr2:157159116..157159135 59.96 50
downstream ENSMUSE00000171435 Chr2:157157515..157157605 ATGCTCTCCAGGGTCATCTG Chr2:157157497..157157516 60.22 55
downstream ENSMUSE00000171434 Chr2:157155233..157155371 CAGAGGACGGAAAAGGTCAG Chr2:157155242..157155261 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTCCCTCTAATCGCCTTG Chr2:157169330..157169350 61.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGTGAGCAAAGCCATGACA Chr2:157169416..157169436 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027643