Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34319
Trapped Gene
A730049H05Rik (ENSMUSG00000048636)
Vector Insertion
Chr 6: 92766655 - 92777910
Public Clones IST10941E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000374401 (Chr6:92766472..92766654 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTGTGTGTCCCGATCTGA Chr6:92766571..92766590 59.68 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000374401 (Chr6:92766472..92766654 +)
Downstram Exon
ENSMUSE00000502186 (Chr6:92777911..92778097 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTGTGTGTCCCGATCTGA Chr6:92766571..92766590 59.68 50 CCAGGGTTGTTTGCAGACTT Chr6:92777941..92777960 60.15 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000374401 Chr6:92766472..92766654 CTTTGTGTGTCCCGATCTGA Chr6:92766571..92766590 59.68 50

*** Putative Vector Insertion (Chr 6: 92766655 - 92777910) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000502186 Chr6:92777911..92778097 CCAGGGTTGTTTGCAGACTT Chr6:92777941..92777960 60.15 50
downstream ENSMUSE00000413874 Chr6:92781931..92782058 AGGCCCTTACACCATTCTCA Chr6:92781961..92781980 59.55 50
downstream ENSMUSE00000331412 Chr6:92784433..92784480 TTCTTCTTCATTGGTCTCTGGA Chr6:92784472..92784493 58.91 40.91
downstream ENSMUSE00000411269 Chr6:92791767..92793461 ACATGTGCCGTTGGTAGTGA Chr6:92792997..92793016 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGGGTGGGTCACTAATCG Chr6:92766692..92766712 61.12 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCATGCTCTCTACAAAGGTCT Chr6:92766610..92766632 59.15 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048636