Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3432
Trapped Gene
Prcc (ENSMUSG00000004895)
Vector Insertion
Chr 3: 87676180 - 87688796
Public Clones AM0708 (sanger) (sanger) XF124 (baygenomics) IST15059D11 (tigm) IST14454H4 (tigm)
IST14123F5 (tigm) IST10524A6 (tigm)
Private Clones OST438141 (lexicon) OST339761 (lexicon) OST139623 (lexicon)
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000175818 (Chr3:87688797..87689503 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000175818 (Chr3:87688797..87689503 -)
Downstram Exon
ENSMUSE00000175822 (Chr3:87676132..87676179 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000175818 Chr3:87688797..87689503 No primer for this exon

*** Putative Vector Insertion (Chr 3: 87676180 - 87688796) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000175822 Chr3:87676132..87676179 No primer for this exon
downstream ENSMUSE00000175819 Chr3:87673505..87674071 No primer for this exon
downstream ENSMUSE00000295372 Chr3:87671237..87671332 No primer for this exon
downstream ENSMUSE00000295360 Chr3:87666053..87666196 No primer for this exon
downstream ENSMUSE00000356432 Chr3:87664068..87664133 No primer for this exon
downstream ENSMUSE00000465061 Chr3:87662839..87663268 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGGGCGATGTGAGTATGG Chr3:87682785..87682805 60.48 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGGGCGATGTGAGTATGG Chr3:87682785..87682805 60.48 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGGCCATTAGGTGTGTGTAG Chr3:87683483..87683503 59.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGGCCATTAGGTGTGTGTAG Chr3:87683483..87683503 59.07 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004895