Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34320
Trapped Gene
Adarb2 (ENSMUSG00000052551)
Vector Insertion
Chr 13: 8751998 - 8756471
Public Clones IST13104H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000455934 (Chr13:8751819..8751997 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGGAAAGTCTCCCCACTT Chr13:8751845..8751864 60.48 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000455934 (Chr13:8751819..8751997 +)
Downstram Exon
ENSMUSE00000684878 (Chr13:8756472..8759554 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGGAAAGTCTCCCCACTT Chr13:8751845..8751864 60.48 55 GCATAGGCCAAAGTGATGGT Chr13:8758877..8758896 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000471563 Chr13:8202467..8202566 AGAGGGTCTGGAGGGCTAAG Chr13:8202491..8202510 59.83 60
upstream ENSMUSE00000468343 Chr13:8558350..8558436 TGTCAACCTTCCTTGCTCCT Chr13:8558365..8558384 59.84 50
upstream ENSMUSE00000465454 Chr13:8568913..8569820 AAACCGAAATGTGAGCAACC Chr13:8568938..8568957 59.98 45
upstream ENSMUSE00000476554 Chr13:8671651..8671765 CGGCCTGACATCTGTGTATG Chr13:8671707..8671726 60.14 55
upstream ENSMUSE00000441669 Chr13:8696866..8697034 GCAGGTCATCGTTCTGTCCT Chr13:8696885..8696904 60.27 55
upstream ENSMUSE00000441655 Chr13:8700826..8700977 AGGTTACAGGCTGCGAGAAA Chr13:8700877..8700896 60.01 50
upstream ENSMUSE00000441646 Chr13:8712846..8713014 AGCAGCAAACACATCGTCAG Chr13:8712851..8712870 60.06 50
upstream ENSMUSE00000441662 Chr13:8731036..8731217 TGCCTCATACCGACAAAACA Chr13:8731183..8731202 60.11 45
upstream ENSMUSE00000455934 Chr13:8751819..8751997 CCAGGAAAGTCTCCCCACTT Chr13:8751845..8751864 60.48 55

*** Putative Vector Insertion (Chr 13: 8751998 - 8756471) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000684878 Chr13:8756472..8759554 GCATAGGCCAAAGTGATGGT Chr13:8758877..8758896 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTAGCCGTACCTGGGCTCT Chr13:8752030..8752050 60.12 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTGCATGGTAGGGTAGGT Chr13:8754985..8755005 61.29 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052551