Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34322
Trapped Gene
Pdzd3 (ENSMUSG00000032105)
Vector Insertion
Chr 9: 44058333 - 44058940
Public Clones IST13693F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000216579 (Chr9:44058866..44058939 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCATTGACAATCCTGTCCT Chr9:44058895..44058914 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000216579 (Chr9:44058866..44058939 -)
Downstram Exon
ENSMUSE00000216578 (Chr9:44058334..44058545 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCATTGACAATCCTGTCCT Chr9:44058895..44058914 59.93 50 TCCTCCTTGCTCAACAGACA Chr9:44058475..44058494 59.54 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000365748 Chr9:44059523..44059547 No primer for this exon
upstream ENSMUSE00000343067 Chr9:44059081..44059108 GGACACGGCCTTGTTAACTC Chr9:44059082..44059101 59.6 55
upstream ENSMUSE00000216579 Chr9:44058866..44058939 GGCATTGACAATCCTGTCCT Chr9:44058895..44058914 59.93 50
upstream ENSMUSE00000216578 Chr9:44058334..44058545 TGTCTGTTGAGCAAGGAGGA Chr9:44058497..44058516 59.54 50

*** Putative Vector Insertion (Chr 9: 44058333 - 44058940) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000216573 Chr9:44057926..44058115 GGACAGAGGAAAGCGTCACT Chr9:44057984..44058003 59.46 55
downstream ENSMUSE00000216575 Chr9:44057694..44057830 CAACCAGAAAGGACCTCGAC Chr9:44057786..44057805 59.7 55
downstream ENSMUSE00000216577 Chr9:44057318..44057522 No primer for this exon
downstream ENSMUSE00000216581 Chr9:44056930..44057126 TCAGGATCGACGACAATGAG Chr9:44056930..44056949 59.79 50
downstream ENSMUSE00000216585 Chr9:44056639..44056845 TGTCTTCAACCGGAAGATCC Chr9:44056736..44056755 60.05 50
downstream ENSMUSE00000216576 Chr9:44056314..44056514 CCCACAGGATATCCGTTCAC Chr9:44056413..44056432 60.19 55
downstream ENSMUSE00000347034 Chr9:44055401..44056099 CCACAGCGTCATCTTCTTGA Chr9:44055730..44055749 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000032105