Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34329
Trapped Gene
Nhedc1 (ENSMUSG00000050150)
Vector Insertion
Chr 3: 135011738 - 135017974
Public Clones IST10282E2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000722138 (Chr3:135011291..135011737 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTCCATCACGACTGACAGC Chr3:135011320..135011339 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000722138 (Chr3:135011291..135011737 +)
Downstram Exon
ENSMUSE00000705513 (Chr3:135017975..135018035 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTCCATCACGACTGACAGC Chr3:135011320..135011339 59.84 50 TGGAAACCATCATCCTTCTTG Chr3:135018018..135018038 59.92 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000705517 Chr3:135011001..135011086 GCGGGTGAGAGTTGCTAAAG Chr3:135011058..135011077 60.01 55
upstream ENSMUSE00000586687 Chr3:135011022..135011086 GCGGGTGAGAGTTGCTAAAG Chr3:135011058..135011077 60.01 55
upstream ENSMUSE00000719634 Chr3:135011291..135011737 TTTCCATCACGACTGACAGC Chr3:135011320..135011339 59.84 50
upstream ENSMUSE00000722138 Chr3:135011291..135011737 TTTCCATCACGACTGACAGC Chr3:135011320..135011339 59.84 50

*** Putative Vector Insertion (Chr 3: 135011738 - 135017974) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000362259 Chr3:135017975..135018035 TGGAAACCATCATCCTTCTTG Chr3:135018018..135018038 59.92 42.86
downstream ENSMUSE00000705513 Chr3:135017975..135018035 TGGAAACCATCATCCTTCTTG Chr3:135018018..135018038 59.92 42.86
downstream ENSMUSE00000413724 Chr3:135020421..135020718 TTCTGGTTCCTTCGGTTCTG Chr3:135020522..135020541 60.22 50
downstream ENSMUSE00000705512 Chr3:135020421..135020718 TTCTGGTTCCTTCGGTTCTG Chr3:135020522..135020541 60.22 50
downstream ENSMUSE00000425940 Chr3:135034809..135034979 AAGGGCCCAGAGTAGAGTCC Chr3:135034852..135034871 59.7 60
downstream ENSMUSE00000425934 Chr3:135036083..135036225 ATCGGAACATTCCTGATGGT Chr3:135036125..135036144 59.22 45
downstream ENSMUSE00000425698 Chr3:135037238..135037365 TGACAAGCGCAGACAGACTC Chr3:135037279..135037298 60.34 55
downstream ENSMUSE00000586688 Chr3:135045650..135045825 AGACAGCGCCTAGGACAAAA Chr3:135045672..135045691 60.01 50
downstream ENSMUSE00000176961 Chr3:135053386..135053492 CGCAAGGACGATAGGATGTT Chr3:135053422..135053441 60.1 50
downstream ENSMUSE00000466512 Chr3:135055064..135055213 CCATGTAAGCCAATGTGCTG Chr3:135055152..135055171 60.13 50
downstream ENSMUSE00000586686 Chr3:135055125..135055213 CCATGTAAGCCAATGTGCTG Chr3:135055152..135055171 60.13 50
downstream ENSMUSE00000705515 Chr3:135055125..135055172 CCATGTAAGCCAATGTGCTG Chr3:135055152..135055171 60.13 50
downstream ENSMUSE00000586685 Chr3:135055661..135056046 GGGGTAGGGACTTTTGCATT Chr3:135055935..135055954 60.19 50
downstream ENSMUSE00000462005 Chr3:135056924..135057032 GAAGCGGCTGAAAAACATTC Chr3:135056978..135056997 59.83 45
downstream ENSMUSE00000464747 Chr3:135057808..135057944 TCGAACAGATAGTGCCAAACC Chr3:135057850..135057870 60.12 47.62
downstream ENSMUSE00000467391 Chr3:135060560..135060788 CTTCGCGTATCCTTCCAAGT Chr3:135060631..135060650 59.34 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGTCCTAATCGCCTTGCAG Chr3:135014783..135014803 61.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCAGACAAACTCCTGAAAGA Chr3:135011714..135011735 58.63 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050150