Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34331
Trapped Gene
Slc3a1 (ENSMUSG00000024131)
Vector Insertion
Chr 17: 85460260 - 85462975
Public Clones IST11942F6 (tigm) IST14619B2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000496163 (Chr17:85460143..85460259 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACACCTGGCTACCCACAAAC Chr17:85460213..85460232 59.89 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000496163 (Chr17:85460143..85460259 +)
Downstram Exon
ENSMUSE00000358845 (Chr17:85462976..85463579 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACACCTGGCTACCCACAAAC Chr17:85460213..85460232 59.89 55 TGCCATTCATGAGTCTGCTC Chr17:85463495..85463514 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000177262 Chr17:85427716..85428198 ACCAATAACGGGTTTGTCCA Chr17:85427829..85427848 60.09 45
upstream ENSMUSE00000244476 Chr17:85431783..85431962 AGAATTTGGTTGCTGCCATC Chr17:85431933..85431952 60.08 45
upstream ENSMUSE00000244454 Chr17:85432099..85432253 ACACGGAGCGGAAAATACAC Chr17:85432170..85432189 60 50
upstream ENSMUSE00000244429 Chr17:85436510..85436635 TTTCCGAAATCCTGCTGTTC Chr17:85436602..85436621 60.19 45
upstream ENSMUSE00000244395 Chr17:85445979..85446098 TTCTGGAAGCGAAGGATCTG Chr17:85446043..85446062 60.47 50
upstream ENSMUSE00000244370 Chr17:85448187..85448311 CACGGTCACCCACTACTCAG Chr17:85448189..85448208 59.17 60
upstream ENSMUSE00000451956 Chr17:85451222..85451417 GCTTGCCATTTATCCAGGAA Chr17:85451278..85451297 60.04 45
upstream ENSMUSE00000407533 Chr17:85459056..85459223 AGTATGTCAACGCCATGCAC Chr17:85459102..85459121 59.6 50
upstream ENSMUSE00000496163 Chr17:85460143..85460259 ACACCTGGCTACCCACAAAC Chr17:85460213..85460232 59.89 55

*** Putative Vector Insertion (Chr 17: 85460260 - 85462975) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000358845 Chr17:85462976..85463579 TGCCATTCATGAGTCTGCTC Chr17:85463495..85463514 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCTGGCTACCCACAAACT Chr17:85460215..85460235 60.03 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCTGGCTACCCACAAACT Chr17:85460215..85460235 60.03 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024131