Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34339
Trapped Gene
Arsb (ENSMUSG00000042082)
Vector Insertion
Chr 13: 94577659 - 94632041
Public Clones IST11278H8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000302995 (Chr13:94577451..94577658 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGAACAACACGGTCTTCA Chr13:94577627..94577646 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000302995 (Chr13:94577451..94577658 +)
Downstram Exon
ENSMUSE00000302987 (Chr13:94632042..94632285 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGAACAACACGGTCTTCA Chr13:94577627..94577646 59.72 50 GCTCTTCACGCCTTTCTGTT Chr13:94632178..94632197 59.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000508556 Chr13:94541634..94542047 CCCAGGTGGATGAAATCTTG Chr13:94541640..94541659 60.31 50
upstream ENSMUSE00000303008 Chr13:94559994..94560180 GGGGATGTACCGGAAAGAAT Chr13:94560125..94560144 60.02 50
upstream ENSMUSE00000303003 Chr13:94563983..94564173 CTTTGAATGGTACCCGCTGT Chr13:94564040..94564059 59.99 50
upstream ENSMUSE00000302995 Chr13:94577451..94577658 CTGGAACAACACGGTCTTCA Chr13:94577627..94577646 59.72 50

*** Putative Vector Insertion (Chr 13: 94577659 - 94632041) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000302987 Chr13:94632042..94632285 GCTCTTCACGCCTTTCTGTT Chr13:94632178..94632197 59.62 50
downstream ENSMUSE00000680497 Chr13:94641766..94641916 CCACAGTCAGGCGATTTTCT Chr13:94641897..94641916 60.26 50
downstream ENSMUSE00000611862 Chr13:94650443..94650513 No primer for this exon
downstream ENSMUSE00000611861 Chr13:94709182..94709304 AAGAATCGTCCTTTGCTGGA Chr13:94709223..94709242 59.81 45
downstream ENSMUSE00000302966 Chr13:94710421..94712971 CAGGGCGAAGAAGTGCTATC Chr13:94711722..94711741 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTTTCTTAATCGCCTTGC Chr13:94580702..94580722 58.97 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTTCTTCCCCATTTGGCTA Chr13:94601612..94601632 60.44 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042082