Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34341
Trapped Gene
Zdhhc1 (ENSMUSG00000039199)
Vector Insertion
Chr 8: 108002651 - 108007684
Public Clones IST14827A1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000359190 (Chr8:108007441..108007683 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACCTCTTCTTCGCGGTGAT Chr8:108007499..108007518 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000359190 (Chr8:108007441..108007683 -)
Downstram Exon
ENSMUSE00000230532 (Chr8:108002652..108002827 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACCTCTTCTTCGCGGTGAT Chr8:108007499..108007518 59.84 50 GTAGCTCTTGTCCCGCACAT Chr8:108002713..108002732 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679999 Chr8:108008089..108008330 CTCATCCCCAGCTGAGAAAC Chr8:108008271..108008290 59.8 55
upstream ENSMUSE00000359190 Chr8:108007441..108007683 TACCTCTTCTTCGCGGTGAT Chr8:108007499..108007518 59.84 50
upstream ENSMUSE00000230532 Chr8:108002652..108002827 ACTGCTGTCTCCATCGATCC Chr8:108002766..108002785 60.23 55

*** Putative Vector Insertion (Chr 8: 108002651 - 108007684) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000230705 Chr8:108000917..108001018 CACTTGCAATGGTGATCGAA Chr8:108000928..108000947 60.67 45
downstream ENSMUSE00000230694 Chr8:108000514..108000638 TGGGGTTGACAAAGAACTCC Chr8:108000522..108000541 59.94 50
downstream ENSMUSE00000230675 Chr8:108000271..108000429 AGCAGGGCTGTAGAAAGCAG Chr8:108000281..108000300 59.78 55
downstream ENSMUSE00000230660 Chr8:107999924..108000036 AGCTCCTTGTGGGTCTCCTT Chr8:107999936..107999955 60.25 55
downstream ENSMUSE00000230637 Chr8:107997384..107997466 ACATGGCTGAAGGTCCTCAT Chr8:107997410..107997429 59.53 50
downstream ENSMUSE00000383550 Chr8:107997106..107997199 AGGAGGGTAGTGGTGGTTCC Chr8:107997125..107997144 60.23 60
downstream ENSMUSE00000397103 Chr8:107996891..107996969 TCTATACACTCGCCGCTTCC Chr8:107996921..107996940 60.37 55
downstream ENSMUSE00000390767 Chr8:107996325..107996781 GGAGCGGATATTGCTGAGTC Chr8:107996341..107996360 59.8 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAACAAACCCTCCAACAAG Chr8:108004652..108004672 60.53 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAACAAACCCTCCAACAAG Chr8:108004652..108004672 60.53 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039199