Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34364
Trapped Gene
A330021E22Rik (ENSMUSG00000040473)
Vector Insertion
Chr 5: 5626008 - 5640228
Public Clones IST13279G7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000386172 (Chr5:5640129..5640227 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000386172 (Chr5:5640129..5640227 -)
Downstram Exon
ENSMUSE00000345486 (Chr5:5626009..5626158 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCTGCAGGACTTTCAGAACC Chr5:5626002..5626021 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000347631 Chr5:5663908..5664181 AGCTCAGCAGCGTGTTTTCT Chr5:5664093..5664112 60.34 50
upstream ENSMUSE00000402663 Chr5:5657788..5657847 CAAGCCTATGGACCTTAATCG Chr5:5657819..5657839 58.73 47.62
upstream ENSMUSE00000361918 Chr5:5649790..5649855 No primer for this exon
upstream ENSMUSE00000390808 Chr5:5646936..5647045 AAATTGAAAAGCAGCCCTGT Chr5:5646974..5646993 58.84 40
upstream ENSMUSE00000347856 Chr5:5644424..5644500 No primer for this exon
upstream ENSMUSE00000386172 Chr5:5640129..5640227 No primer for this exon
upstream ENSMUSE00000345486 Chr5:5626009..5626158 GGCACTCCTGCTTGAGAATC Chr5:5626063..5626082 59.96 55

*** Putative Vector Insertion (Chr 5: 5626008 - 5640228) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000333667 Chr5:5625750..5625927 CTGAGGGATCTGGGTCATTG Chr5:5625828..5625847 60.47 55
downstream ENSMUSE00000389664 Chr5:5621920..5622043 GACTATGCCCCCTCACAAAG Chr5:5621975..5621994 59.55 55
downstream ENSMUSE00000402443 Chr5:5619167..5619215 AAATCCCTGGTAAAGCCACA Chr5:5619171..5619190 59.43 45
downstream ENSMUSE00000361655 Chr5:5618948..5619069 CTTTTTACCAAGGGGTTTTGA Chr5:5619020..5619040 58.15 38.1
downstream ENSMUSE00000351918 Chr5:5617169..5617385 ATGCAAGGATCCGAGAATTG Chr5:5617171..5617190 60.04 45
downstream ENSMUSE00000301156 Chr5:5613686..5613850 CATCTGGGCGAACTTGTTTC Chr5:5613761..5613780 60.64 50
downstream ENSMUSE00000301152 Chr5:5604274..5604392 CTCAGCAGGTCTGCTCATCA Chr5:5604336..5604355 60.29 55
downstream ENSMUSE00000301144 Chr5:5595921..5596039 CATTGTAGCCTAAACCCCTCTG Chr5:5595930..5595951 60.01 50
downstream ENSMUSE00000301138 Chr5:5593772..5593853 AACATCCCAAAATGCAGCAC Chr5:5593812..5593831 60.9 45
downstream ENSMUSE00000379846 Chr5:5589175..5589213 AATTAAAAGGCTGGCAGCAG Chr5:5589162..5589181 59.5 45
downstream ENSMUSE00000301133 Chr5:5589120..5589312 AACAATCTTGCCGTTCCTGT Chr5:5589099..5589118 59.6 45
downstream ENSMUSE00000369220 Chr5:5587141..5587278 AAGGGGCATGGTCTTTTGTT Chr5:5587201..5587220 60.72 45
downstream ENSMUSE00000301126 Chr5:5586356..5586432 GGCAGATAAGCCCGGTAAGT Chr5:5586382..5586401 60.47 55
downstream ENSMUSE00000301117 Chr5:5584651..5584848 GACGCAACCATCTTTCCAAT Chr5:5584699..5584718 59.94 45
downstream ENSMUSE00000301108 Chr5:5582442..5582528 CCATGACTTGTTAGCCTGCTC Chr5:5582462..5582482 59.89 52.38
downstream ENSMUSE00000301102 Chr5:5581904..5582008 TGTTGCATTCTGTGGTCGTT Chr5:5581918..5581937 60.16 45
downstream ENSMUSE00000391705 Chr5:5579282..5581366 CAGGGCAACCTAGACACCAT Chr5:5579368..5579387 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr5:5634160..5634180 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCCTTCTCGCAGGTGAGTT Chr5:5634219..5634239 58.89 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040473