Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34393
Trapped Gene
Fyco1 (ENSMUSG00000025241)
Vector Insertion
Chr 9: 123732295 - 123734795
Public Clones IST12227E12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000226514 (Chr9:123734627..123734794 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGATGCTTGCAGACCTCGAT Chr9:123734680..123734699 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000226514 (Chr9:123734627..123734794 -)
Downstram Exon
ENSMUSE00000226488 (Chr9:123732296..123732448 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGATGCTTGCAGACCTCGAT Chr9:123734680..123734699 59.98 50 CTTCCAGTGCATCGGATTTT Chr9:123732386..123732405 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633372 Chr9:123760534..123760687 GAAAGCCAAACCCTCCTCTC Chr9:123760572..123760591 60.19 55
upstream ENSMUSE00000633371 Chr9:123754274..123754390 GGCCATAGCACTGAGTGAGAG Chr9:123754336..123754356 60.03 57.14
upstream ENSMUSE00000226712 Chr9:123752580..123752729 AGTCTGACCATTGCTGACCA Chr9:123752698..123752717 59.26 50
upstream ENSMUSE00000149201 Chr9:123749663..123749769 ATTTAAGGAAGGCGGAGAGC Chr9:123749725..123749744 59.82 50
upstream ENSMUSE00000226662 Chr9:123747993..123748118 GGCATTCGATTTGTCAGGTC Chr9:123748003..123748022 60.47 50
upstream ENSMUSE00000226643 Chr9:123743914..123744020 GGAGAGCCTTCATTCGCTAC Chr9:123743979..123743998 59.03 55
upstream ENSMUSE00000226623 Chr9:123742219..123742362 GCTCTGACATTGTGGGTCAA Chr9:123742299..123742318 59.68 50
upstream ENSMUSE00000226609 Chr9:123740408..123740498 CACCAGCACGTCTGCTTACA Chr9:123740467..123740486 61.08 55
upstream ENSMUSE00000226590 Chr9:123737297..123739600 GCCTGGTAGCAGAACTCCAG Chr9:123739334..123739353 60.01 60
upstream ENSMUSE00000226565 Chr9:123736206..123736298 CCAGCAGCTGCAAATGACTA Chr9:123736229..123736248 60.16 50
upstream ENSMUSE00000226542 Chr9:123735667..123735785 AATTGCACCAGTAGCCACCT Chr9:123735736..123735755 59.62 50
upstream ENSMUSE00000226514 Chr9:123734627..123734794 AGATGCTTGCAGACCTCGAT Chr9:123734680..123734699 59.98 50
upstream ENSMUSE00000226488 Chr9:123732296..123732448 AAAATCCGATGCACTGGAAG Chr9:123732408..123732427 60.07 45

*** Putative Vector Insertion (Chr 9: 123732295 - 123734795) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000226466 Chr9:123731436..123731647 TCCTATGGACTGGGGACTTG Chr9:123731421..123731440 59.92 55
downstream ENSMUSE00000226445 Chr9:123728165..123728309 GTGTTTCAGGCAAGGAGGAG Chr9:123728183..123728202 59.84 55
downstream ENSMUSE00000633370 Chr9:123710340..123710435 GGGCACGTCTTCAGTGTCTT Chr9:123710365..123710384 60.31 55
downstream ENSMUSE00000226357 Chr9:123706635..123706845 AAGACCCAGCTGATGGTGAG Chr9:123706689..123706708 60.26 55
downstream ENSMUSE00000226321 Chr9:123703843..123703952 CTCCTTGTGGGAATTGCATC Chr9:123703892..123703911 60.46 50
downstream ENSMUSE00000574468 Chr9:123698628..123701867 TCAGGGATCCCAGTCTCATC Chr9:123698687..123698706 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTCCCAGAACACAGAAGG Chr9:123734782..123734802 60.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTCCCAGAACACAGAAGG Chr9:123734782..123734802 60.23 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025241