Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3441
Trapped Gene
Taf1c (ENSMUSG00000031832)
Vector Insertion
Chr 8: 122127366 - 122128139
Public Clones AS0135 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000213575 (Chr8:122128140..122128278 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGACCTGTCCTTCATGTGC Chr8:122128191..122128210 59.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000213575 (Chr8:122128140..122128278 -)
Downstram Exon
ENSMUSE00000213561 (Chr8:122127281..122127365 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGACCTGTCCTTCATGTGC Chr8:122128191..122128210 59.26 55 TGGCTCCCACAGTAGGTTCT Chr8:122127302..122127321 59.72 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000213553 Chr8:122129035..122129129 No primer for this exon
upstream ENSMUSE00000213575 Chr8:122128140..122128278 CTGACCTGTCCTTCATGTGC Chr8:122128191..122128210 59.26 55

*** Putative Vector Insertion (Chr 8: 122127366 - 122128139) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213561 Chr8:122127281..122127365 TGGCTCCCACAGTAGGTTCT Chr8:122127302..122127321 59.72 55
downstream ENSMUSE00000213574 Chr8:122127050..122127147 GCTCAGTGACATCCAGCACA Chr8:122127030..122127049 61.07 55
downstream ENSMUSE00000213556 Chr8:122126890..122126979 CCCTCCAATCTGAAGTTCTCC Chr8:122126875..122126895 60.06 52.38
downstream ENSMUSE00000213576 Chr8:122126731..122126804 AGCTTCTTCGCGCTGACTAT Chr8:122126742..122126761 59.39 50
downstream ENSMUSE00000579790 Chr8:122125442..122125680 GCTTCCCCATGAGTAGTGACA Chr8:122125564..122125584 60.13 52.38
downstream ENSMUSE00000213571 Chr8:122125216..122125332 TTGCCACCTGAAGTCACACT Chr8:122125277..122125296 59.31 50
downstream ENSMUSE00000213573 Chr8:122125011..122125128 CCACGTGGCACAGTGATAGT Chr8:122125066..122125085 59.62 55
downstream ENSMUSE00000213569 Chr8:122124851..122124922 No primer for this exon
downstream ENSMUSE00000213557 Chr8:122124561..122124696 TCGGTGTCCTTGTAGATCGTC Chr8:122124648..122124668 60.13 52.38
downstream ENSMUSE00000213565 Chr8:122124334..122124471 CCTAGGTACTGGGCAAGCAG Chr8:122124358..122124377 59.89 60
downstream ENSMUSE00000213559 Chr8:122123716..122123890 ATGGTCCCACTTAAGCATGG Chr8:122123809..122123828 59.81 50
downstream ENSMUSE00000213562 Chr8:122123481..122123618 GATGGAGGGCAGAGACTGAG Chr8:122123541..122123560 59.94 60
downstream ENSMUSE00000370117 Chr8:122121874..122123403 ACACGAAGTGGACTGGTTCC Chr8:122122317..122122336 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTGTTCCTCCTCCTTGCTC Chr8:122128088..122128108 59.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGTTCCTCCTCCTTGCTC Chr8:122128088..122128108 59.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031832