Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34427
Trapped Gene
Ubash3b (ENSMUSG00000032020)
Vector Insertion
Chr 9: 40859399 - 40965799
Public Clones IST14309G8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000637717 (Chr9:40965382..40965798 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCAGGAAGCGTCAGTCTC Chr9:40965626..40965645 60.13 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000637717 (Chr9:40965382..40965798 -)
Downstram Exon
ENSMUSE00000340278 (Chr9:40859400..40859453 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCAGGAAGCGTCAGTCTC Chr9:40965626..40965645 60.13 60 GTGGATGCCAGAGCTTTTTG Chr9:40859411..40859430 60.78 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637717 Chr9:40965382..40965798 CTCCAGGAAGCGTCAGTCTC Chr9:40965626..40965645 60.13 60
upstream ENSMUSE00000340278 Chr9:40859400..40859453 CAAAAAGCTCTGGCATCCAC Chr9:40859433..40859452 60.78 50

*** Putative Vector Insertion (Chr 9: 40859399 - 40965799) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000399904 Chr9:40858523..40858709 AGATGTTGTGGGCCTTGTTC Chr9:40858533..40858552 59.97 50
downstream ENSMUSE00000215887 Chr9:40854964..40855162 GACTTCAGCGCTGTCTTCCT Chr9:40854991..40855010 59.75 55
downstream ENSMUSE00000215880 Chr9:40851558..40851727 ACCGGATATCCCGAGAGAAT Chr9:40851550..40851569 59.75 50
downstream ENSMUSE00000215874 Chr9:40845520..40845728 GTCAGCGAGGTGCCATAAAT Chr9:40845573..40845592 60.1 50
downstream ENSMUSE00000271233 Chr9:40839564..40839696 CTTCATACTGCCGCCTCTCT Chr9:40839595..40839614 59.6 55
downstream ENSMUSE00000215884 Chr9:40837722..40837842 CCCAAATACAACGTCCATCC Chr9:40837734..40837753 60.05 50
downstream ENSMUSE00000215886 Chr9:40836100..40836222 TGTTCAGGTTGGTGCGTATG Chr9:40836174..40836193 60.57 50
downstream ENSMUSE00000271469 Chr9:40834333..40834425 GGAGGGATGGTGAGCAATAC Chr9:40834344..40834363 59.37 55
downstream ENSMUSE00000271442 Chr9:40831504..40831648 GGTATCCATGCCGGTAATGT Chr9:40831530..40831549 59.53 50
downstream ENSMUSE00000391806 Chr9:40826100..40826206 TTTCGTCACCTGGAAACTCC Chr9:40826106..40826125 60.09 50
downstream ENSMUSE00000348998 Chr9:40824681..40824790 TGACAGGTACACGCTTCGAG Chr9:40824714..40824733 60.05 55
downstream ENSMUSE00000346556 Chr9:40821709..40823119 TCTGCAAAAGGCCAGTTCTT Chr9:40822923..40822942 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGGGTTCCCTCTGGTACT Chr9:40869752..40869772 59.68 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGGGTTCCCTCTGGTACT Chr9:40869752..40869772 59.68 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032020