Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34441
Trapped Gene
Ryk (ENSMUSG00000032547)
Vector Insertion
Chr 9: 102793616 - 102799531
Public Clones IST10195A10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220649 (Chr9:102793546..102793615 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCAGGTGACGATGATGCTC Chr9:102793561..102793580 59.79 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220649 (Chr9:102793546..102793615 +)
Downstram Exon
ENSMUSE00000220654 (Chr9:102799532..102799664 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCAGGTGACGATGATGCTC Chr9:102793561..102793580 59.79 50 TAATTTGCACTGCCGAAGAA Chr9:102799646..102799665 59.44 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000321294 Chr9:102737250..102737569 TCTACCTGAGCGAGGACGAG Chr9:102737534..102737553 60.69 60
upstream ENSMUSE00000321268 Chr9:102764204..102764325 GCCCAGTGAGACAAACTTCC Chr9:102764277..102764296 59.7 55
upstream ENSMUSE00000321249 Chr9:102769885..102769984 GAGGTCCCACGCACTTTATC Chr9:102769963..102769982 59.56 55
upstream ENSMUSE00000220661 Chr9:102771604..102771738 GGTCGAGCTTTCTTGTACCG Chr9:102771611..102771630 59.88 55
upstream ENSMUSE00000220653 Chr9:102774058..102774111 TTCAGCCTTGGACAAAAACAC Chr9:102774077..102774097 60.14 42.86
upstream ENSMUSE00000220651 Chr9:102778069..102778213 TCCACGCGTGTGTTTTACAT Chr9:102778098..102778117 60.03 45
upstream ENSMUSE00000220647 Chr9:102783984..102784084 GACACACCCAACAATGCAAC Chr9:102784054..102784073 59.86 50
upstream ENSMUSE00000220656 Chr9:102788324..102788458 GAACGACTTGCGAAGTGTCA Chr9:102788358..102788377 60.03 50
upstream ENSMUSE00000220655 Chr9:102790800..102790886 CTTTTGGGCGTATTTTCCAT Chr9:102790803..102790822 58.94 40
upstream ENSMUSE00000220649 Chr9:102793546..102793615 TTCAGGTGACGATGATGCTC Chr9:102793561..102793580 59.79 50

*** Putative Vector Insertion (Chr 9: 102793616 - 102799531) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220654 Chr9:102799532..102799664 TAATTTGCACTGCCGAAGAA Chr9:102799646..102799665 59.44 40
downstream ENSMUSE00000220652 Chr9:102800789..102800898 GACCAGATCTTGCTGGGAAA Chr9:102800815..102800834 60.19 50
downstream ENSMUSE00000220645 Chr9:102801021..102801180 CCTGTTCTCGTTGTCCCCTA Chr9:102801120..102801139 60.1 55
downstream ENSMUSE00000220657 Chr9:102808367..102808503 TGGGCTATTCGGTAACCATC Chr9:102808482..102808501 59.78 50
downstream ENSMUSE00000382229 Chr9:102809180..102810637 AAACAAGCGATTTTCCATGC Chr9:102809903..102809922 60.08 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr9:102796665..102796685 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGATACGTGACTGGGAAAAC Chr9:102796660..102796682 59.9 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032547