Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34449
Trapped Gene
Zfyve9 (ENSMUSG00000034557)
Vector Insertion
Chr 4: 108400060 - 108453109
Public Clones IST14990A1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000670782 (Chr4:108453058..108453108 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTCTCGGCTGAGTGACGAC Chr4:108453078..108453097 63.68 65 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000670782 (Chr4:108453058..108453108 -)
Downstram Exon
ENSMUSE00000670781 (Chr4:108400061..108400150 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTCTCGGCTGAGTGACGAC Chr4:108453078..108453097 63.68 65 GCAGTCTTCTCTGTGCTTGCT Chr4:108400051..108400071 59.95 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000670776 Chr4:108453058..108453403 GCTCTCGGCTGAGTGACGAC Chr4:108453078..108453097 63.68 65
upstream ENSMUSE00000670782 Chr4:108453058..108453108 GCTCTCGGCTGAGTGACGAC Chr4:108453078..108453097 63.68 65
upstream ENSMUSE00000670781 Chr4:108400061..108400150 AGCAAGCACAGAGAAGACTGC Chr4:108400073..108400093 59.95 52.38

*** Putative Vector Insertion (Chr 4: 108400060 - 108453109) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000670780 Chr4:108396412..108396517 GGTTGTAAGCCTCTGCTTGG Chr4:108396426..108396445 59.88 55
downstream ENSMUSE00000712012 Chr4:108396412..108396481 CCAGGTTGTAAGCCTCTGCT Chr4:108396423..108396442 59.5 55
downstream ENSMUSE00000718549 Chr4:108396412..108396481 CCAGGTTGTAAGCCTCTGCT Chr4:108396423..108396442 59.5 55
downstream ENSMUSE00000670793 Chr4:108390394..108392417 AGATGAAGCCGCACAGAGAT Chr4:108391767..108391786 59.98 50
downstream ENSMUSE00000670791 Chr4:108368374..108368473 CTCTGGCTTCCTTTCTGTCC Chr4:108368385..108368404 59.01 55
downstream ENSMUSE00000631543 Chr4:108365925..108366101 CTCCCACAGGTACCATCACA Chr4:108365927..108365946 59.39 55
downstream ENSMUSE00000631542 Chr4:108364227..108364396 ATCCCATCAGCAAACCAAAC Chr4:108364329..108364348 59.8 45
downstream ENSMUSE00000631541 Chr4:108361754..108361874 TTCCAACAGGACTTCCAACC Chr4:108361798..108361817 59.94 50
downstream ENSMUSE00000631540 Chr4:108357514..108357636 TTGCTGCATGACTGAAATCTG Chr4:108357568..108357588 60 42.86
downstream ENSMUSE00000631539 Chr4:108354739..108354894 CATGCATCCCTTTGGTTGTA Chr4:108354828..108354847 59.4 45
downstream ENSMUSE00000631538 Chr4:108353507..108353731 AACAGGTAAGGAGGGGTTGG Chr4:108353571..108353590 60.22 55
downstream ENSMUSE00000631537 Chr4:108350315..108350397 ATGGCTTCCGAAATCTGACA Chr4:108350334..108350353 60.6 45
downstream ENSMUSE00000631536 Chr4:108347058..108347162 ACCTTGGACAACTGGCAGAG Chr4:108347099..108347118 60.3 55
downstream ENSMUSE00000269658 Chr4:108333170..108333320 TCTGCCTTTTCATTGAAGCA Chr4:108333228..108333247 59.54 40
downstream ENSMUSE00000269651 Chr4:108329532..108329612 CTGGACTTGGCAAGGTATCC Chr4:108329521..108329540 59.55 55
downstream ENSMUSE00000269644 Chr4:108322789..108322951 GAGTCCATGTTCTCCGCAGT Chr4:108322890..108322909 60.27 55
downstream ENSMUSE00000269636 Chr4:108316941..108317046 TCTGATGACTTTTCCGTTTGC Chr4:108316928..108316948 60.24 42.86
downstream ENSMUSE00000269625 Chr4:108314693..108314869 GTCACACGGAGTCCCAGTTT Chr4:108314687..108314706 60.01 55
downstream ENSMUSE00000707976 Chr4:108311864..108312025 AGGCTCCTCCATGAATGACA Chr4:108311907..108311926 60.62 50
downstream ENSMUSE00000708983 Chr4:108311864..108312025 AGGCTCCTCCATGAATGACA Chr4:108311907..108311926 60.62 50
downstream ENSMUSE00000670779 Chr4:108310071..108312025 TGCAGGCAAGAAAACATCAG Chr4:108310510..108310529 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTCTTAATCGCCTTGCAG Chr4:108432044..108432064 58.53 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr4:108432042..108432062 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034557