Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34465
Trapped Gene
Itgb4 (ENSMUSG00000020758)
Vector Insertion
Chr 11: 115850334 - 115851035
Public Clones IST14157F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000108977 (Chr11:115850204..115850333 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000108977 (Chr11:115850204..115850333 +)
Downstram Exon
ENSMUSE00000669992 (Chr11:115851036..115851155 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000669993 Chr11:115836023..115836123 No primer for this exon
upstream ENSMUSE00000670027 Chr11:115836039..115836468 No primer for this exon
upstream ENSMUSE00000575602 Chr11:115836287..115836468 No primer for this exon
upstream ENSMUSE00000436677 Chr11:115839100..115839191 No primer for this exon
upstream ENSMUSE00000719766 Chr11:115839100..115839191 No primer for this exon
upstream ENSMUSE00000436674 Chr11:115840390..115840472 No primer for this exon
upstream ENSMUSE00000436668 Chr11:115840675..115840776 No primer for this exon
upstream ENSMUSE00000404591 Chr11:115840928..115841132 No primer for this exon
upstream ENSMUSE00000108982 Chr11:115841989..115842085 No primer for this exon
upstream ENSMUSE00000108985 Chr11:115842255..115842426 No primer for this exon
upstream ENSMUSE00000108981 Chr11:115844015..115844278 No primer for this exon
upstream ENSMUSE00000355925 Chr11:115844573..115844662 No primer for this exon
upstream ENSMUSE00000436645 Chr11:115844957..115845079 No primer for this exon
upstream ENSMUSE00000394834 Chr11:115845351..115845515 No primer for this exon
upstream ENSMUSE00000362960 Chr11:115846336..115846412 No primer for this exon
upstream ENSMUSE00000108990 Chr11:115847931..115848133 No primer for this exon
upstream ENSMUSE00000108995 Chr11:115849774..115849877 No primer for this exon
upstream ENSMUSE00000108989 Chr11:115849971..115850069 No primer for this exon
upstream ENSMUSE00000108977 Chr11:115850204..115850333 No primer for this exon

*** Putative Vector Insertion (Chr 11: 115850334 - 115851035) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000253668 Chr11:115851033..115851155 No primer for this exon
downstream ENSMUSE00000669992 Chr11:115851036..115851155 No primer for this exon
downstream ENSMUSE00000342344 Chr11:115851252..115851358 No primer for this exon
downstream ENSMUSE00000436620 Chr11:115851989..115852022 No primer for this exon
downstream ENSMUSE00000436615 Chr11:115852198..115852389 No primer for this exon
downstream ENSMUSE00000513451 Chr11:115852623..115852726 No primer for this exon
downstream ENSMUSE00000253635 Chr11:115852972..115853030 No primer for this exon
downstream ENSMUSE00000253627 Chr11:115853200..115853223 No primer for this exon
downstream ENSMUSE00000253622 Chr11:115854369..115854517 No primer for this exon
downstream ENSMUSE00000253618 Chr11:115854591..115854770 No primer for this exon
downstream ENSMUSE00000253610 Chr11:115855576..115855724 No primer for this exon
downstream ENSMUSE00000253603 Chr11:115859264..115859468 No primer for this exon
downstream ENSMUSE00000575601 Chr11:115859264..115859459 No primer for this exon
downstream ENSMUSE00000253597 Chr11:115861112..115861269 No primer for this exon
downstream ENSMUSE00000253591 Chr11:115861553..115861733 No primer for this exon
downstream ENSMUSE00000253584 Chr11:115861857..115861994 No primer for this exon
downstream ENSMUSE00000253577 Chr11:115864656..115864838 No primer for this exon
downstream ENSMUSE00000253572 Chr11:115864917..115865048 No primer for this exon
downstream ENSMUSE00000670001 Chr11:115866218..115866412 No primer for this exon
downstream ENSMUSE00000253569 Chr11:115866845..115867081 No primer for this exon
downstream ENSMUSE00000575600 Chr11:115867211..115867369 No primer for this exon
downstream ENSMUSE00000378354 Chr11:115867775..115867924 No primer for this exon
downstream ENSMUSE00000253547 Chr11:115868300..115868488 No primer for this exon
downstream ENSMUSE00000253539 Chr11:115868573..115868728 No primer for this exon
downstream ENSMUSE00000253533 Chr11:115868815..115868979 No primer for this exon
downstream ENSMUSE00000253524 Chr11:115869069..115869179 No primer for this exon
downstream ENSMUSE00000366722 Chr11:115869275..115869726 No primer for this exon
downstream ENSMUSE00000669994 Chr11:115869275..115869725 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTGACGATTGCCCCTTTA Chr11:115850285..115850305 60.89 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGTGACGATTGCCCCTTTA Chr11:115850285..115850305 60.89 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020758