Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34473
Trapped Gene
B4galnt2 (ENSMUSG00000013418)
Vector Insertion
Chr 11: 95724872 - 95728284
Public Clones IST12392E9 (tigm) IST12392E9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000110896 (Chr11:95728064..95728283 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000110896 (Chr11:95728064..95728283 -)
Downstram Exon
ENSMUSE00000648516 (Chr11:95724873..95727590 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661431 Chr11:95776134..95776185 No primer for this exon
upstream ENSMUSE00000674177 Chr11:95753658..95753668 No primer for this exon
upstream ENSMUSE00000661430 Chr11:95753072..95753287 No primer for this exon
upstream ENSMUSE00000674180 Chr11:95752287..95752424 No primer for this exon
upstream ENSMUSE00000291477 Chr11:95750121..95750227 No primer for this exon
upstream ENSMUSE00000291471 Chr11:95745257..95745294 No primer for this exon
upstream ENSMUSE00000110895 Chr11:95737412..95737592 No primer for this exon
upstream ENSMUSE00000110893 Chr11:95735176..95735262 No primer for this exon
upstream ENSMUSE00000110898 Chr11:95730548..95730735 No primer for this exon
upstream ENSMUSE00000110894 Chr11:95729664..95729804 No primer for this exon
upstream ENSMUSE00000110896 Chr11:95728064..95728283 No primer for this exon
upstream ENSMUSE00000648516 Chr11:95724873..95727590 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTTCCTTAATCGCCTTGC Chr11:95725221..95725241 58.47 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTTCAGGCTGCTGTATGC Chr11:95725232..95725252 59.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013418