Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34479
Trapped Gene
Fance (ENSMUSG00000007570)
Vector Insertion
Chr 17: 28459717 - 28463096
Public Clones IST11595G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700644 (Chr17:28459591..28459716 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700644 (Chr17:28459591..28459716 +)
Downstram Exon
ENSMUSE00000720134 (Chr17:28463097..28463198 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700630 Chr17:28450475..28450827 No primer for this exon
upstream ENSMUSE00000700654 Chr17:28450492..28450827 No primer for this exon
upstream ENSMUSE00000400901 Chr17:28450507..28450677 No primer for this exon
upstream ENSMUSE00000700624 Chr17:28450511..28450827 No primer for this exon
upstream ENSMUSE00000700645 Chr17:28450589..28450827 No primer for this exon
upstream ENSMUSE00000657902 Chr17:28450742..28450827 No primer for this exon
upstream ENSMUSE00000610151 Chr17:28452544..28453132 No primer for this exon
upstream ENSMUSE00000700652 Chr17:28452544..28453132 No primer for this exon
upstream ENSMUSE00000610150 Chr17:28453804..28453848 No primer for this exon
upstream ENSMUSE00000700649 Chr17:28453804..28453848 No primer for this exon
upstream ENSMUSE00000407608 Chr17:28454103..28454168 No primer for this exon
upstream ENSMUSE00000700648 Chr17:28454103..28454168 No primer for this exon
upstream ENSMUSE00000713593 Chr17:28454413..28454556 No primer for this exon
upstream ENSMUSE00000719812 Chr17:28454413..28454556 No primer for this exon
upstream ENSMUSE00000721054 Chr17:28454413..28454556 No primer for this exon
upstream ENSMUSE00000361313 Chr17:28454978..28455101 No primer for this exon
upstream ENSMUSE00000657900 Chr17:28455007..28455101 No primer for this exon
upstream ENSMUSE00000700627 Chr17:28455007..28455101 No primer for this exon
upstream ENSMUSE00000657897 Chr17:28455274..28455352 No primer for this exon
upstream ENSMUSE00000657899 Chr17:28455274..28455352 No primer for this exon
upstream ENSMUSE00000657896 Chr17:28457735..28457801 No primer for this exon
upstream ENSMUSE00000657898 Chr17:28457735..28457801 No primer for this exon
upstream ENSMUSE00000610143 Chr17:28459591..28459716 No primer for this exon
upstream ENSMUSE00000700644 Chr17:28459591..28459716 No primer for this exon

*** Putative Vector Insertion (Chr 17: 28459717 - 28463096) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000368305 Chr17:28463097..28463511 No primer for this exon
downstream ENSMUSE00000700626 Chr17:28463097..28463512 No primer for this exon
downstream ENSMUSE00000700646 Chr17:28463097..28463511 No primer for this exon
downstream ENSMUSE00000717577 Chr17:28463097..28463198 No primer for this exon
downstream ENSMUSE00000720134 Chr17:28463097..28463198 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGCCCCTGTCTTCTTTGA Chr17:28459725..28459745 60.74 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGCCCCTGTCTTCTTTGA Chr17:28459725..28459745 60.74 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007570