Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34488
Trapped Gene
A630012P03Rik (ENSMUSG00000055110)
Vector Insertion
Chr X: 49947470 - 49970815
Public Clones IST11978E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000436125 (ChrX:49947344..49947469 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACACCAAAAGTGCACCATCA ChrX:49947414..49947433 60.01 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000436125 (ChrX:49947344..49947469 +)
Downstram Exon
ENSMUSE00000710444 (ChrX:49970816..49972224 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACACCAAAAGTGCACCATCA ChrX:49947414..49947433 60.01 45 AATGAGGCGAGACAGTTGCT ChrX:49970839..49970858 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000436146 ChrX:49929020..49929307 TGAAGGAAGTTCCCGATGAC ChrX:49929040..49929059 60.05 50
upstream ENSMUSE00000436132 ChrX:49937230..49937296 TCATTGCAATTGTCCTCCAA ChrX:49937270..49937289 60.05 40
upstream ENSMUSE00000436128 ChrX:49938755..49938836 CCTTGAGGAAGAGTGGCTGA ChrX:49938801..49938820 60.52 55
upstream ENSMUSE00000700798 ChrX:49947342..49947469 ACACCAAAAGTGCACCATCA ChrX:49947414..49947433 60.01 45
upstream ENSMUSE00000436125 ChrX:49947344..49947469 ACACCAAAAGTGCACCATCA ChrX:49947414..49947433 60.01 45

*** Putative Vector Insertion (Chr X: 49947470 - 49970815) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000710444 ChrX:49970816..49972224 AATGAGGCGAGACAGTTGCT ChrX:49970839..49970858 60.02 50
downstream ENSMUSE00000710715 ChrX:49970816..49972224 AATGAGGCGAGACAGTTGCT ChrX:49970839..49970858 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTGAAATGTGGTGAGGTC ChrX:49950423..49950443 60.36 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTGAAATGTGGTGAGGTC ChrX:49950423..49950443 60.36 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055110