Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34497
Trapped Gene
Adamtsl4 (ENSMUSG00000015850)
Vector Insertion
Chr 3: 95480123 - 95480893
Public Clones IST14371D8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000389156 (Chr3:95480127..95480892 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000389156 (Chr3:95480127..95480892 -)
Downstram Exon
ENSMUSE00000720708 (Chr3:95480124..95480892 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000502296 Chr3:95491744..95491781 No primer for this exon
upstream ENSMUSE00000716153 Chr3:95491744..95491840 No primer for this exon
upstream ENSMUSE00000449694 Chr3:95489379..95489476 No primer for this exon
upstream ENSMUSE00000710947 Chr3:95489379..95489594 No primer for this exon
upstream ENSMUSE00000449684 Chr3:95488882..95488939 No primer for this exon
upstream ENSMUSE00000449680 Chr3:95488284..95488621 No primer for this exon
upstream ENSMUSE00000449678 Chr3:95487556..95488162 No primer for this exon
upstream ENSMUSE00000449676 Chr3:95487231..95487333 No primer for this exon
upstream ENSMUSE00000449674 Chr3:95486133..95486269 No primer for this exon
upstream ENSMUSE00000449670 Chr3:95485575..95485779 No primer for this exon
upstream ENSMUSE00000449668 Chr3:95485183..95485355 No primer for this exon
upstream ENSMUSE00000449664 Chr3:95484947..95485058 No primer for this exon
upstream ENSMUSE00000449659 Chr3:95484660..95484845 No primer for this exon
upstream ENSMUSE00000449654 Chr3:95484368..95484497 No primer for this exon
upstream ENSMUSE00000449650 Chr3:95483914..95484118 No primer for this exon
upstream ENSMUSE00000176255 Chr3:95483511..95483687 No primer for this exon
upstream ENSMUSE00000176257 Chr3:95481731..95481928 No primer for this exon
upstream ENSMUSE00000176256 Chr3:95481451..95481630 No primer for this exon
upstream ENSMUSE00000176258 Chr3:95481034..95481178 No primer for this exon
upstream ENSMUSE00000389156 Chr3:95480127..95480892 No primer for this exon
upstream ENSMUSE00000720708 Chr3:95480124..95480892 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGCCATTGACCTCTGTCCT Chr3:95480894..95480914 60.12 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCCATTGACCTCTGTCCT Chr3:95480894..95480914 60.12 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015850