Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34515
Trapped Gene
2700094K13Rik (ENSMUSG00000076437)
Vector Insertion
Chr 2: 84509381 - 84510274
Public Clones (sanger) (sanger) PST19209-NR (escells) IST14303G5 (tigm) IST14682A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000718550 (Chr2:84510169..84510273 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACGAAAGCTCAAATTTCC Chr2:84510219..84510238 59.69 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000718550 (Chr2:84510169..84510273 -)
Downstram Exon
ENSMUSE00000662180 (Chr2:84509382..84509554 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACGAAAGCTCAAATTTCC Chr2:84510219..84510238 59.69 45 TGCCTCACAACTGAACCATC Chr2:84509419..84509438 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662179 Chr2:84510640..84510852 CCTATGGAGACGGTGGACAA Chr2:84510685..84510704 60.91 55
upstream ENSMUSE00000662183 Chr2:84510640..84510865 CCTATGGAGACGGTGGACAA Chr2:84510685..84510704 60.91 55
upstream ENSMUSE00000708438 Chr2:84510640..84510865 CCTATGGAGACGGTGGACAA Chr2:84510685..84510704 60.91 55
upstream ENSMUSE00000662182 Chr2:84510402..84510547 GCTACCTGTGCAAGTGAACC Chr2:84510459..84510478 58.37 55
upstream ENSMUSE00000718550 Chr2:84510169..84510273 CCACGAAAGCTCAAATTTCC Chr2:84510219..84510238 59.69 45
upstream ENSMUSE00000662181 Chr2:84510144..84510273 CCACGAAAGCTCAAATTTCC Chr2:84510219..84510238 59.69 45
upstream ENSMUSE00000662178 Chr2:84509981..84510273 CAGGGAACGTCTCCTTACCA Chr2:84510087..84510106 60.1 55
upstream ENSMUSE00000662180 Chr2:84509382..84509554 GCATTTATGATGGTGCATGG Chr2:84509511..84509530 59.78 45

*** Putative Vector Insertion (Chr 2: 84509381 - 84510274) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000721448 Chr2:84509375..84509554 TGCCTCACAACTGAACCATC Chr2:84509419..84509438 59.68 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTTTATCCCATCCTTTCC Chr2:84510275..84510295 59.74 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTTTATCCCATCCTTTCC Chr2:84510275..84510295 59.74 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000076437