Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34532
Trapped Gene
Sfmbt1 (ENSMUSG00000006527)
Vector Insertion
Chr 14: 31529775 - 31579185
Public Clones IST14920A2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000690685 (Chr14:31529677..31529774 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000690685 (Chr14:31529677..31529774 +)
Downstram Exon
ENSMUSE00000437119 (Chr14:31579186..31579287 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690701 Chr14:31528035..31528152 No primer for this exon
upstream ENSMUSE00000690696 Chr14:31528801..31529061 No primer for this exon
upstream ENSMUSE00000690685 Chr14:31529677..31529774 No primer for this exon

*** Putative Vector Insertion (Chr 14: 31529775 - 31579185) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000690699 Chr14:31579149..31579287 No primer for this exon
downstream ENSMUSE00000437119 Chr14:31579186..31579287 No primer for this exon
downstream ENSMUSE00000489016 Chr14:31582985..31583079 No primer for this exon
downstream ENSMUSE00000491216 Chr14:31587071..31587311 No primer for this exon
downstream ENSMUSE00000488354 Chr14:31591090..31591178 No primer for this exon
downstream ENSMUSE00000490450 Chr14:31597129..31597375 No primer for this exon
downstream ENSMUSE00000122320 Chr14:31597887..31597975 No primer for this exon
downstream ENSMUSE00000122338 Chr14:31599000..31599101 No primer for this exon
downstream ENSMUSE00000122349 Chr14:31600643..31600793 No primer for this exon
downstream ENSMUSE00000122322 Chr14:31603920..31604002 No primer for this exon
downstream ENSMUSE00000122330 Chr14:31609512..31609638 No primer for this exon
downstream ENSMUSE00000122309 Chr14:31610762..31610875 No primer for this exon
downstream ENSMUSE00000122332 Chr14:31612927..31612969 No primer for this exon
downstream ENSMUSE00000122311 Chr14:31615044..31615105 No primer for this exon
downstream ENSMUSE00000122316 Chr14:31615718..31615857 No primer for this exon
downstream ENSMUSE00000122327 Chr14:31623482..31623591 No primer for this exon
downstream ENSMUSE00000122324 Chr14:31624575..31624750 No primer for this exon
downstream ENSMUSE00000122346 Chr14:31628260..31628438 No primer for this exon
downstream ENSMUSE00000122317 Chr14:31628594..31628839 No primer for this exon
downstream ENSMUSE00000122343 Chr14:31629934..31630062 No primer for this exon
downstream ENSMUSE00000241344 Chr14:31630894..31631149 No primer for this exon
downstream ENSMUSE00000443915 Chr14:31630894..31635899 No primer for this exon
downstream ENSMUSE00000690683 Chr14:31630894..31631532 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr14:31541823..31541843 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCATTTCTAACGTGACTGG Chr14:31541815..31541835 58.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006527