Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34539
Trapped Gene
AU018091 (ENSMUSG00000054753)
Vector Insertion
Chr 7: 3159429 - 3161410
Public Clones IST14671H6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000441049 (Chr7:3161232..3161409 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGTGCTGTGTTTCGTCTC Chr7:3161325..3161344 59.88 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000441049 (Chr7:3161232..3161409 -)
Downstram Exon
ENSMUSE00000573723 (Chr7:3159430..3159542 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGTGCTGTGTTTCGTCTC Chr7:3161325..3161344 59.88 50 ACAGTCGAACCCAATGAAGG Chr7:3159421..3159440 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000573725 Chr7:3169016..3169204 ACATTTCCGGTGGCTACTTG Chr7:3169132..3169151 59.99 50
upstream ENSMUSE00000441056 Chr7:3163894..3164298 CACTTTGGACCTGGTGTCCT Chr7:3164146..3164165 60 55
upstream ENSMUSE00000441054 Chr7:3162203..3162361 TATCCAAGTGCCCAGCTTTC Chr7:3162254..3162273 60.21 50
upstream ENSMUSE00000441049 Chr7:3161232..3161409 TTGGTGCTGTGTTTCGTCTC Chr7:3161325..3161344 59.88 50
upstream ENSMUSE00000573723 Chr7:3159430..3159542 CCTTCATTGGGTTCGACTGT Chr7:3159443..3159462 59.97 50

*** Putative Vector Insertion (Chr 7: 3159429 - 3161410) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000441038 Chr7:3159053..3159275 CCCATCCAACGTGGATAAAT Chr7:3159083..3159102 59.51 45
downstream ENSMUSE00000441029 Chr7:3158756..3158895 GCTAGGACCGGAGTGTGTGT Chr7:3158760..3158779 60.18 60
downstream ENSMUSE00000441026 Chr7:3158556..3158658 CTGAGCTCAACGAGGAAAGC Chr7:3158609..3158628 60.28 55
downstream ENSMUSE00000441023 Chr7:3158219..3158430 CTCAGAGTTGGGGTGGTGTT Chr7:3158235..3158254 60 55
downstream ENSMUSE00000441017 Chr7:3157906..3158072 AGAGGAGTGGTGCTCTGAGG Chr7:3157894..3157913 59.58 60
downstream ENSMUSE00000573717 Chr7:3156267..3156375 ATCCAGATTCCAAAGCGAAA Chr7:3156253..3156272 59.65 40
downstream ENSMUSE00000441058 Chr7:3154665..3156109 GCATCCCGTTTCTCCAGTTA Chr7:3155940..3155959 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTTTTAATCGCCTTGCAG Chr7:3161345..3161365 59.72 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTTCTTTCCATTCCCTTT Chr7:3161415..3161435 59.53 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054753