Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34573
Trapped Gene
Calr3 (ENSMUSG00000019732)
Vector Insertion
Chr 8: 74958862 - 74962535
Public Clones IST13115C10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000463549 (Chr8:74962331..74962534 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000463549 (Chr8:74962331..74962534 -)
Downstram Exon
ENSMUSE00000711368 (Chr8:74958863..74959055 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000581765 Chr8:74967492..74967677 No primer for this exon
upstream ENSMUSE00000501544 Chr8:74967294..74967395 No primer for this exon
upstream ENSMUSE00000463549 Chr8:74962331..74962534 No primer for this exon
upstream ENSMUSE00000682241 Chr8:74958863..74959055 No primer for this exon
upstream ENSMUSE00000711368 Chr8:74958863..74959055 No primer for this exon

*** Putative Vector Insertion (Chr 8: 74958862 - 74962535) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000465370 Chr8:74958689..74958783 No primer for this exon
downstream ENSMUSE00000213088 Chr8:74955272..74955460 No primer for this exon
downstream ENSMUSE00000682239 Chr8:74952056..74952064 No primer for this exon
downstream ENSMUSE00000682238 Chr8:74952010..74952054 No primer for this exon
downstream ENSMUSE00000520195 Chr8:74951969..74952064 No primer for this exon
downstream ENSMUSE00000514932 Chr8:74951061..74951192 No primer for this exon
downstream ENSMUSE00000516671 Chr8:74949666..74949758 No primer for this exon
downstream ENSMUSE00000607079 Chr8:74948451..74948654 No primer for this exon
downstream ENSMUSE00000682240 Chr8:74948082..74948654 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr8:74959464..74959484 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000019732