Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3459
Trapped Gene
Mcph1 (ENSMUSG00000039842)
Vector Insertion
Chr 8: 18597015 - 18607278
Public Clones XR0655 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000367954 (Chr8:18596923..18597014 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACGTTTGCAAAGCAACTT Chr8:18596977..18596996 60.29 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000367954 (Chr8:18596923..18597014 +)
Downstram Exon
ENSMUSE00000361861 (Chr8:18607279..18607397 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACGTTTGCAAAGCAACTT Chr8:18596977..18596996 60.29 45 TCACATGGGTCACTTGCTTG Chr8:18607318..18607337 60.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000374723 Chr8:18595173..18595635 GGCTGTCGTGTGTCACTGAG Chr8:18595413..18595432 60.53 60
upstream ENSMUSE00000367954 Chr8:18596923..18597014 GGACGTTTGCAAAGCAACTT Chr8:18596977..18596996 60.29 45

*** Putative Vector Insertion (Chr 8: 18597015 - 18607278) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000361861 Chr8:18607279..18607397 TCACATGGGTCACTTGCTTG Chr8:18607318..18607337 60.72 50
downstream ENSMUSE00000408228 Chr8:18622607..18622694 CTGCAGGGAACAAAGACTCA Chr8:18622656..18622675 59.01 50
downstream ENSMUSE00000434141 Chr8:18625560..18625674 CTGCCTTTTGCCTTTGTAGC Chr8:18625671..18625690 60.02 50
downstream ENSMUSE00000226129 Chr8:18627118..18627240 CAGGAGGACAGGAACGTCAT Chr8:18627143..18627162 60.11 55
downstream ENSMUSE00000226124 Chr8:18629546..18629635 TTCTGCTGAGACTGCTCCAA Chr8:18629579..18629598 59.85 50
downstream ENSMUSE00000226116 Chr8:18631516..18632643 AAGAAGCCTCAACGTCAGGA Chr8:18632052..18632071 59.99 50
downstream ENSMUSE00000226106 Chr8:18641565..18641665 CCTGTGCAAGAGCTGTCTGA Chr8:18641619..18641638 60.33 55
downstream ENSMUSE00000226097 Chr8:18668946..18668983 No primer for this exon
downstream ENSMUSE00000226089 Chr8:18671092..18671254 ACCTGGATGATGAGGGTCTG Chr8:18671118..18671137 59.92 55
downstream ENSMUSE00000226081 Chr8:18688982..18689059 AATCCAGTGGCCCAACTCTA Chr8:18689017..18689036 59.55 50
downstream ENSMUSE00000434172 Chr8:18788239..18788476 TCGGCTGATTAGCAAAGAGG Chr8:18788308..18788327 60.48 50
downstream ENSMUSE00000332013 Chr8:18801406..18803186 ACTGGGGACACCAACAAGAG Chr8:18802460..18802479 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGACGTTTGCAAAGCAACTT Chr8:18605978..18605998 60.29 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTTATGCGTGACTGG Chr8:18606055..18606075 59.86 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039842