Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34597
Trapped Gene
Zdhhc21 (ENSMUSG00000028403)
Vector Insertion
Chr 4: 82452916 - 82466351
Public Clones IST13597D3 (tigm) IST13760H3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000178874 (Chr4:82466234..82466350 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTTTGTTGTTCGCCATGAG Chr4:82466327..82466346 59.84 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000178874 (Chr4:82466234..82466350 -)
Downstram Exon
ENSMUSE00000178870 (Chr4:82452917..82452960 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTTTGTTGTTCGCCATGAG Chr4:82466327..82466346 59.84 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672480 Chr4:82505823..82505862 No primer for this exon
upstream ENSMUSE00000632167 Chr4:82505394..82505446 No primer for this exon
upstream ENSMUSE00000450338 Chr4:82499873..82500019 GGCCCATACGATGGAATATG Chr4:82499971..82499990 60 50
upstream ENSMUSE00000317307 Chr4:82493447..82493643 GGGTCTTCGGATTCACTTTG Chr4:82493579..82493598 59.53 50
upstream ENSMUSE00000717454 Chr4:82493447..82493643 GGGTCTTCGGATTCACTTTG Chr4:82493579..82493598 59.53 50
upstream ENSMUSE00000178875 Chr4:82490008..82490106 AGGGCCTCCTTAACTGATCC Chr4:82490046..82490065 59.54 55
upstream ENSMUSE00000178872 Chr4:82484180..82484291 GAGCTCTGCAACAAGTGCAA Chr4:82484258..82484277 60.33 50
upstream ENSMUSE00000178871 Chr4:82481350..82481488 GCTGCTTACTTGCTACGCACT Chr4:82481405..82481425 59.87 52.38
upstream ENSMUSE00000178874 Chr4:82466234..82466350 TCTTTGTTGTTCGCCATGAG Chr4:82466327..82466346 59.84 45
upstream ENSMUSE00000178870 Chr4:82452917..82452960 No primer for this exon

*** Putative Vector Insertion (Chr 4: 82452916 - 82466351) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000672479 Chr4:82452113..82452365 CCAACGAGTGCCAAAAACTT Chr4:82452286..82452305 60.15 45
downstream ENSMUSE00000178869 Chr4:82450856..82452365 TCAGAGAGCTGCTCCTAGCC Chr4:82451676..82451695 60 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTTGTTGTTCGCCATGAG Chr4:82457325..82457345 59.84 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTTGTTGTTCGCCATGAG Chr4:82457325..82457345 59.84 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028403